C21orf45 (MIS18A) (NM_018944) Human Untagged Clone
CAT#: SC320574
MIS18A (untagged)-Human MIS18 kinetochore protein homolog A (S. pombe) (MIS18A)
"NM_018944" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | C21orf45 |
Synonyms | B28; C21orf45; C21orf46; FASP1; hMis18alpha; MIS18alpha |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_018944.2
CTCTGGGGCGCGGGCGATTTGTAGGTAATGGCAGGCGTTCGGTCACTGAGGTGTAGCAGA
GGATGCGCTGGCGGCTGTGAGTGCGGCGACAAGGGCAAATGCAGCGACTCCTCGCTGTTG GGCAAGAGACTCTCCGAAGACTCGAGCCGCCACCAGCTGTTGCAGAAGTGGGCGAGCATG TGGAGCTCCATGAGCGAAGACGCGTCGGTGGCCGACATGGAGAGGGCGCAGCTGGAGGAG GAGGCGGCGGCTGCGGAGGAGAGGCCGCTGGTGTTCCTGTGCTCCGGCTGCCGGCGGCCG CTGGGCGACTCGCTGAGCTGGGTGGCCAGCCAGGAGGACACCAACTGCATCCTGCTTCGC TGTGTTTCCTGTAATGTTTCTGTGGATAAGGAACAGAAGCTATCCAAACGTGAAAAGGAA AATGGTTGCGTCCTTGAGACTTTGTGCTGCGCGGGGTGCTCACTCAATCTTGGCTACGTG TACAGATGCACGCCCAAGAATCTTGATTACAAGAGAGACTTGTTTTGCCTCAGTGTTGAA GCCATTGAAAGTTATGTTTTAGGGTCCTCTGAAAAGCAAATTGTGTCAGAAGATAAAGAG CTTTTTAATCTTGAAAGCAGAGTTGAAATAGAAAAGTCTCTAACACAGATGGAAGATGTC TTGAAAGCATTACAAATGAAGCTGTGGGAGGCCGAATCCAAATTGTCCTTTGCCACTTGT AAAAGCTGAACTCTAGTCTGTGTCCTCCATTCTGCCCCCGCCCTTCCTCCCCTTATTTGT TAAATGAAGCAACATAGTGAGACGTCGTCTCTACAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_018944 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_018944.2, NP_061817.1 |
RefSeq Size | 1587 bp |
RefSeq ORF | 702 bp |
Locus ID | 54069 |
UniProt ID | Q9NYP9 |
Cytogenetics | 21q22.11 |
Gene Summary | Required for recruitment of CENPA to centromeres and normal chromosome segregation during mitosis.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208316 | MIS18A (Myc-DDK-tagged)-Human MIS18 kinetochore protein homolog A (S. pombe) (MIS18A) |
USD 300.00 |
|
RC208316L3 | Lenti ORF clone of Human MIS18 kinetochore protein homolog A (S. pombe) (MIS18A), Myc-DDK-tagged |
USD 600.00 |
|
RC208316L4 | Lenti ORF clone of Human MIS18 kinetochore protein homolog A (S. pombe) (MIS18A), mGFP tagged |
USD 600.00 |
|
RG208316 | MIS18A (tGFP-tagged) - Human MIS18 kinetochore protein homolog A (S. pombe) (MIS18A) |
USD 500.00 |
|
SC113340 | MIS18A (untagged)-Human MIS18 kinetochore protein homolog A (S. pombe) (MIS18A) |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review