NDUFV2 (NM_021074) Human Untagged Clone

CAT#: SC319467

NDUFV2 (untagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa (NDUFV2), nuclear gene encoding mitochondrial protein

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NDUFV2
• Synonyms: CI-24k; MC1DN7
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_021074.1 GGAAGGTGAACAGTGTGGCCCGCCATGTTCTTCTCCGCGGCGCTCCGGGCCCGGGCGGCT
  GGCCTCACCGCCCACTGGGGAAGACATGTAAGGAATTTGCATAAGACAGTTATGCAAAAT
  GGAGCTGGAGGAGCTTTATTTGTGCACAGAGATACTCCTGAGAATAACCCTGATACTCCA
  TTTGATTTCACACCAGAAAACTATAAGAGGATAGAGGCAATTGTAAAAAACTATCCAGAA
  GGCCATAAAGCAGCAGCTGTTCTTCCAGTCCTGGATTTAGCCCAAAGGCAGAATGGGTGG
  TTGCCCATCTCTGCTATGAACAAGGTTGCAGAAGTTTTACAAGTACCTCCAATGAGAGTA
  TATGAAGTAGCAACTTTTTATACAATGTATAATCGAAAGCCAGTTGGAAAGTATCACATT
  CAGGTCTGCACTACTACACCCTGCATGCTTCGAAACTCTGACAGCATACTGGAGGCCATT
  CAGAAAAAGCTTGGAATAAAGGTTGGGGAGACTACACCTGACAAACTTTTCACTCTTATA
  GAAGTGGAATGTTTAGGGGCCTGTGTGAACGCACCAATGGTTCAAATAAATGACAATTAC
  TATGAGGATTTGACAGCTAAGGATATTGAAGAAATTATTGATGAGCTCAAGGCTGGCAAA
  ATCCCAAAACCAGGGCCAAGGAGTGGACGCTTCTCTTGTGAGCCAGCTGGAGGTCTTACC
  TCTTTGACTGAACCACCCAAGGGACCTGGATTTGGTGTACAAGCAGGCCTTTAATTTATA
  TTGAACTGTAAATATGTCACTAGAGAAATAAAATATGGACTTCCAATCTACGTAAAAAAA
  AAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_021074
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_021074.1, NP_066552.1
• RefSeq Size: 827 bp
• RefSeq ORF: 750 bp
• Locus ID: 4729
• UniProt ID: P19404
• Cytogenetics: 18p11.22
• Domains: complex1_24kD
• Protein Families: Druggable Genome
• Protein Pathways: Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• Gene Summary: The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes the 24 kDa subunit of complex I, and is involved in electron transfer. Mutations in this gene are implicated in Parkinson's disease, bipolar disorder, schizophrenia, and have been found in one case of early onset hypertrophic cardiomyopathy and encephalopathy. A non-transcribed pseudogene of this locus is found on chromosome 19. [provided by RefSeq, Oct 2009]