FUS2 (NAT6) (NM_012191) Human Untagged Clone

CAT#: SC319094

NAT6 (untagged)-Human N-acetyltransferase 6 (GCN5-related) (NAT6), transcript variant 1


  "NM_012191" in other vectors (5)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-NAT6 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "FUS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FUS2
Synonyms FUS-2; FUS2; HsNAAA80; NAT6
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_012191.2 GGCGACTGAGTGAGATACCCAGCTGTGCGGAGCTAGGACGCGGAACATCCCAGAGGCCAG
CATCAACATGCAAGAGCTGACTCTGAGCCCTGGCCCAGCCAAGCTGACCCCTACACTAGA
CCCTACACACCGGATGGAGCTGATCCTGAGTACCAGCCCAGCTGAGCTGACTCTGGATCC
TGCGTGCCAGCCAAAGCTGCCCCTGGATTCCACATGCCAACCAGAGATGACCTTCAATCC
TGGTCCAACTGAGCTTACCCTGGATCCTGAACACCAGCCAGAGGAGACCCCAGCTCCTAG
CCTGGCTGAGTTGACCCTGGAGCCTGTGCACCGCCGACCCGAGCTCCTGGATGCTTGTGC
TGACCTCATCAATGATCAGTGGCCCCGCAGCCGCACCTCCCGCCTGCACTCCCTGGGCCA
GTCCTCAGATGCCTTCCCCCTCTGCCTGATGCTGCTAAGCCCCCACCCCACACTTGAAGC
AGCACCCGTTGTGGTGGGCCATGCCCGCCTGTCACGGGTGCTGAACCAGCCCCAGAGCCT
CTTAGTGGAGACAGTGGTGGTGGCCCGGGCCCTGAGGGGCCGTGGCTTTGGCCGCCGCCT
CATGGAGGGCCTGGAGGTCTTTGCTCGGGCCCGGGGCTTCCGCAAGCTGCATCTCACCAC
CCATGACCAGGTGCACTTCTATACCCACCTGGGCTACCAGCTGGGTGAGCCTGTGCAGGG
CCTGGTCTTCACCAGCAGACGGCTGCCTGCCACCCTGCTTAATGCCTTCCCCACAGCCCC
CTCTCCCCGGCCACCCAGGAAGGCCCCAAACCTGACTGCCCAAGCTGCCCCAAGGGGTCC
CAAGGGACCTCCATTGCCACCACCCCCTCCCCTACCTGAGTGCCTGACCATCTCACCCCC
AGTTCCATCAGGGCCCCCTTCAAAAAGCCTGCTGGAGACACAATATCAAAATGTGAGGGG
GCGCCCCATATTCTGGATGGAAAAAGACATCTGAGGCCATCCAGGGCAAGGAACTGTCTT
TCTGGTTCAATAGACTGCCCCGACAGTCTACAAGCCTCAGCCCACTGACCATACCTCAGC
CCCTAGCCCCTGGGGGGCAGCTTTAACCTGGGCATGTTTCCTGGGTACCAGTGGGGCCAG
GAGGTGGCTCTGGCTCAGAGCCGTCAGTGTGGCTGAATAAAGGCTCTCTTGGGTAAAAAA
AAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_012191
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_012191.2, NP_036323.2
RefSeq Size 1218 bp
RefSeq ORF 927 bp
Locus ID 24142
UniProt ID Q93015
Cytogenetics 3p21.31
Domains Acetyltransf
Protein Pathways Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism
Gene Summary This gene encodes a member of the N-acetyltransferase family. N-acetyltransferases modify proteins by transferring acetyl groups from acetyl CoA to the N-termini of protein substrates. The encoded protein is a cytoplasmic N-acetyltransferase with a substrate specificity for proteins with an N-terminal methionine. This gene is located in the tumor suppressor gene region on chromosome 3p21.3 and the encoded protein may play a role in cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed. This gene overlaps and is on the same strand as hyaluronoglucosaminidase 3, and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.