RTBDN (NM_001080997) Human Untagged Clone

CAT#: SC315930

RTBDN (untagged)-Human retbindin (RTBDN), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RTBDN
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC315930 representing NM_001080997.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGACTGCAGGGTCCACATGCGACCCATCGGCCTGACGTGGGTGCTGCAACTGACCTTGGCATGGATC
  CTGCTAGAAGCCTGTGGAGGGAGCCGCCCACTCCAAGCCAGGTCCCAGCAACACCATGGGCTGGCAGCT
  GATCTGGGCAAAGGCAAGCTGCACCTGGCAGGACCTTGTTGTCCCTCAGAGATGGACACAACAGAGACA
  TCGGGCCCTGGAAACCATCCAGAACGCTGTGGAGTGCCGAGCCCTGAATGCGAATCCTTCCTGGAACAC
  CTCCAACGTGCCCTTCGCAGTCGCTTCCGCCTGCGGCTATTGGGGGTACGCCAGGCACAGCCGCTCTGC
  GAGGAGCTCTGCCAGGCCTGGTTCGCCAACTGCGAAGATGATATCACCTGCGGCCCGACTTGGCTCCCA
  CTCTCAGAAAAAAGGGGCTGTGAGCCCAGCTGCCTTACCTATGGACAGACCTTCGCAGACGGGACGGAC
  CTTTGTCGCTCGGCTCTGGGCCACGCCCTACCGGTGGCTGCTCCTGGAGCCCGTCACTGCTTCAACATC
  TCCATCTCCGCGGTACCTCGTCCCAGACCAGGACGACGGGGCCGGGAAGCTCCCTCCCGGCGTTCCCGC
  AGCCCTCGCACCTCCATCCTGGACGCTGCGGGCAGCGGGAGTGGCAGTGGAAGCGGCAGCGGCCCCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001080997
• Insert Size: 690 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001080997.2
• RefSeq Size: 1089 bp
• RefSeq ORF: 690 bp
• Locus ID: 83546
• UniProt ID: Q9BSG5
• Cytogenetics: 19p13.13
• Protein Families: Druggable Genome, Secreted Protein
• MW: 24.6 kDa
• Gene Summary: This gene was first identified in a study of human eye tissues. The protein encoded by this gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (1) encodes isoform (1). Variants 1, 6 and 7 encode the same isoform.