SEMA6D (AK022831) Human Untagged Clone

CAT#: SC313595

(untagged)-Human cDNA FLJ12769 fis, clone NT2RP2001581


Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-SEMA6D Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SEMA6D"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SEMA6D
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK022831, the custom clone sequence may differ by one or more nucleotides
ATGCTGCTGTTAACCGAAGACTTCTTTGCTTTCCATAACCACAGTGCTGAAGGATATGAA
CAAGACACAGAATTCGGCAACACAGCTCATCTAGGGGACTGCCATGGTGTACGATGGGAA
GTCCAGTCGGGAGAGTCCAACCAGATGGTCCACATGAATGTCCTCATCACCTGTGTCTTT
GCTGCTTTTGTTTCGGGGGCATTCATTGCAGGTGTGGCAGTATACTGCTATCGAGACATG
TTTGTTCGGAAAAACAGAAAGATCCATAAAGATGCAGAGTCCGCCCAGTCATGCACAGAC
TCCAGTGGAAGTTTTGCCAAACTGAATGGTCTCTTTGACAGCCCTGTCAAGGAATACCAA
CAGAATATTGATTCTCCTAAACTGTATAGTAACCTGCTAACCAGTCGGAAAGAGCTACCA
CCCAATGGAGATACTAAATCCATGGTAATGGACCATCGAGGGCAACCTCCAGAGTTGGCT
GCTCTTCCTACTCCTGAGTCTACACCCGTGCTTCACCAGAAGACCCTGCAGGCCATGAAG
AGCCACTCAGAAAAGGCCCATGGCCATGGAGCTTCAAGGAAAGAAACCCCTCAGTTTTTT
CCGTCTAGTCCGCCACCTCATTCCCCATTAAGTCATGGGCATATCCCCAGTGCCATTGTT
CTTCCAAATGCTACCCATGACTACAACACGTCTTTCTCAAACTCCAATGCTCACAAAGCT
GAAAAGAAGCTTCAAAACATTGATCACCCTCTCACAAAGTCATCCAGTAAGAGAGATCAC
CGGCGTTCTGTTGATTCCAGAAATACCCTCAATGATCTCCTGAAGCATCTGAATGACCCA
AATAGTAACCCCAAAGCCATCATGGGAGACATCCAGATGGCACACCAGAACTTAATGCTG
GATCCCATGGGATCGATGTCTGAGGTCCCACCTAAAGTCCCTAACCGGGAGGCATCGCTA
TACTCCCCTCCTTCAACTCTCCCCAGAAATAGCCCAACCAAGCGAGTGGATGTCCCCACC
ACTCCTGGAGTCCCAATGACTTCTCTGGAAAGACAAAGAGGTTATCACAAAAATTCCTCC
CAGAGGCACTCTATATCTGCTATGCCTAAAAACTTAAACTCACCAAATGGTGTTTTGTTA
TCCAGACAGCCTAGTATGAACCGTGGAGGATATATGCCCACCCCCACTGGGGCGAAGGTG
GACTATATTCAGGGAACACCAGTGAGTGTTCATCTGCAGCCTTCCCTCTCCAGACAGAGC
AGCTACACCAGTAATGGCACTCTTCCTAGGACGGGACTAAAGAGGACGCCGTCCTTAAAA
CCTGACGTGCCACCAAAGCCTTCCTTTGTTCCTCAAACCCCATCTGTCAGACCACTGAAC
AAATACACATAC
Restriction Sites Please inquire     
ACCN AK022831
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq AK022831.1, BAB14264.1
RefSeq Size 2581 bp
RefSeq ORF 1395 bp
Locus ID 80031
Cytogenetics 15q21.1
Protein Families Druggable Genome, Transmembrane
Protein Pathways Axon guidance
Gene Summary Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.