TIA1 (NM_022037) Human Untagged Clone

CAT#: SC313200

TIA1 (untagged)-Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 1


  "NM_022037" in other vectors (6)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TIA1 mouse monoclonal antibody, clone OTI1D7 (formerly 1D7)
    • 100 ul

USD 478.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "TIA1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TIA1
Synonyms ALS26; TIA-1; WDM
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_022037 edited
ATGGAGGACGAGATGCCCAAGACTCTATACGTCGGTAACCTTTCCAGAGATGTGACAGAA
GCTCTAATTCTGCAACTCTTTAGCCAGATTGGACCTTGTAAAAACTGCAAAATGATTATG
GATACAGCTGGAAATGATCCCTATTGTTTTGTGGAGTTTCATGAGCATCGTCATGCAGCT
GCAGCATTAGCTGCTATGAATGGACGGAAGATAATGGGTAAGGAAGTCAAAGTGAATTGG
GCAACAACCCCTAGCAGTCAAAAGAAAGATACAAGCAATCATTTCCATGTCTTTGTTGGT
GATCTCAGCCCAGAAATTACAACTGAAGATATAAAAGCTGCTTTTGCACCATTTGGAAGA
ATATCAGATGCCCGAGTGGTAAAAGACATGGCAACAGGAAAGTCTAAGGGATATGGCTTT
GTCTCCTTTTTCAACAAATGGGATGCTGAAAACGCCATTCAACAGATGGGTGGCCAGTGG
CTTGGTGGAAGACAAATCAGAACTAACTGGGCAACCCGAAAGCCTCCCGCTCCAAAGAGT
ACATATGAGTCAAATACCAAACAGCTATCATATGATGAGGTTGTAAATCAGTCTAGTCCA
AGCAACTGTACTGTATACTGTGGAGGTGTTACTTCTGGGCTAACAGAACAACTAATGCGT
CAGACTTTTTCACCATTTGGACAAATAATGGAAATTCGAGTCTTTCCAGATAAAGGATAT
TCATTTGTTCGGTTCAATTCCCATGAAAGTGCAGCACATGCAATTGTTTCTGTTAATGGT
ACTACCATTGAAGGTCATGTTGTGAAATGCTATTGGGGCAAAGAAACTCTTGATATGATA
AATCCCGTGCAACAGCAGAATCAAATTGGATATCCCCAACCTTATGGCCAGTGGGGCCAG
TGGTATGGAAATGCACAACAAATTGGCCAGTATATGCCTAATGGTTGGCAAGTTCCTGCA
TATGGAATGTATGGCCAGGCATGGAACCAGCAAGGATTTAATCAGACACAGTCTTCTGCA
CCATGGATGGGACCAAATTATGGAGTGCAACCGCCTCAAGGGCAAAATGGCAGCATGTTG
CCCAATCAGCCTTCTGGGTATCGAGTGGCAGGGTATGAAACCCAGTGA
Restriction Sites Please inquire     
ACCN NM_022037
Insert Size 4600 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_022037.1, NP_071320.1
RefSeq Size 2357 bp
RefSeq ORF 1128 bp
Locus ID 7072
UniProt ID P31483
Cytogenetics 2p13.3
Domains RRM, RRM_1
Protein Families Druggable Genome
Gene Summary The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms has been found for this gene. [provided by RefSeq, May 2017]
Transcript Variant: This variant (1) is missing exon 5, which is included in transcript variant 2, resulting in the shorter isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.