RNASEH2B (NM_024570) Human Untagged Clone

CAT#: SC312913

RNASEH2B (untagged)-Human ribonuclease H2, subunit B (RNASEH2B), transcript variant 1


  "NM_024570" in other vectors (6)

Reconstitution Protocol

USD 450.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
RNASEH2B Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "RNASEH2B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RNASEH2B
Synonyms AGS2; DLEU8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312913 representing NM_024570.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCGCTGGCGTGGACTGCGGGGACGGGGTTGGCGCCCGGCAGCACGTGTTCCTGGTTTCAGAATAT
TTAAAAGATGCTTCAAAGAAGATGAAAAATGGGCTAATGTTTGTAAAACTGGTTAACCCCTGTTCAGGA
GAAGGAGCCATTTACTTGTTCAATATGTGTCTACAGCAGCTGTTTGAAGTAAAAGTTTTCAAGGAAAAA
CACCATTCTTGGTTTATAAATCAATCAGTTCAATCAGGAGGTCTTCTCCATTTTGCCACACCTGTGGAT
CCTCTATTTCTGCTTCTCCACTACCTCATAAAGGCTGATAAGGAGGGGAAGTTTCAGCCCCTTGATCAA
GTTGTGGTGGATAACGTGTTTCCAAATTGCATCTTGTTGCTGAAACTTCCTGGACTTGAGAAGTTACTT
CATCATGTGACAGAGGAAAAAGGTAATCCAGAAATAGACAACAAGAAATATTACAAGTACAGCAAAGAG
AAGACATTAAAGTGGCTGGAAAAAAAGGTTAATCAAACTGTGGCAGCATTAAAAACCAATAATGTGAAT
GTCAGTTCCCGGGTACAGTCAACTGCATTTTTCTCTGGTGACCAAGCTTCCACTGACAAGGAAGAGGAT
TATATTCGTTATGCCCATGGTCTGATATCTGACTACATCCCTAAAGAATTAAGTGATGACTTATCTAAA
TACTTAAAGCTTCCAGAACCTTCAGCCTCATTGCCAAATCCTCCATCAAAGAAAATAAAGTTATCAGAT
GAGCCTGTAGAAGCAAAAGAAGATTACACTAAGTTTAATACTAAAGATTTGAAGACTGAAAAGAAAAAT
AGCAAAATGACTGCAGCTCAGAAGGCTTTGGCTAAAGTTGACAAGAGTGGAATGAAAAGTATTGATACC
TTTTTTGGGGTAAAAAATAAAAAAAAAATTGGAAAGGTTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_024570
Insert Size 939 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_024570.3
RefSeq Size 1691 bp
RefSeq ORF 939 bp
Locus ID 79621
UniProt ID Q5TBB1
Cytogenetics 13q14.3
Protein Pathways DNA replication
MW 35.1 kDa
Gene Summary RNase H2 is composed of a single catalytic subunit (A) and two non-catalytic subunits (B and C) and specifically degrades the RNA of RNA:DNA hybrids. The protein encoded by this gene is the non-catalytic B subunit of RNase H2, which is thought to play a role in DNA replication. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Aicardi-Goutieres syndrome type 2 (AGS2). [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.