RNASEH2B (NM_024570) Human Untagged Clone
CAT#: SC312913
RNASEH2B (untagged)-Human ribonuclease H2, subunit B (RNASEH2B), transcript variant 1
"NM_024570" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RNASEH2B |
Synonyms | AGS2; DLEU8 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC312913 representing NM_024570.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCGCTGGCGTGGACTGCGGGGACGGGGTTGGCGCCCGGCAGCACGTGTTCCTGGTTTCAGAATAT TTAAAAGATGCTTCAAAGAAGATGAAAAATGGGCTAATGTTTGTAAAACTGGTTAACCCCTGTTCAGGA GAAGGAGCCATTTACTTGTTCAATATGTGTCTACAGCAGCTGTTTGAAGTAAAAGTTTTCAAGGAAAAA CACCATTCTTGGTTTATAAATCAATCAGTTCAATCAGGAGGTCTTCTCCATTTTGCCACACCTGTGGAT CCTCTATTTCTGCTTCTCCACTACCTCATAAAGGCTGATAAGGAGGGGAAGTTTCAGCCCCTTGATCAA GTTGTGGTGGATAACGTGTTTCCAAATTGCATCTTGTTGCTGAAACTTCCTGGACTTGAGAAGTTACTT CATCATGTGACAGAGGAAAAAGGTAATCCAGAAATAGACAACAAGAAATATTACAAGTACAGCAAAGAG AAGACATTAAAGTGGCTGGAAAAAAAGGTTAATCAAACTGTGGCAGCATTAAAAACCAATAATGTGAAT GTCAGTTCCCGGGTACAGTCAACTGCATTTTTCTCTGGTGACCAAGCTTCCACTGACAAGGAAGAGGAT TATATTCGTTATGCCCATGGTCTGATATCTGACTACATCCCTAAAGAATTAAGTGATGACTTATCTAAA TACTTAAAGCTTCCAGAACCTTCAGCCTCATTGCCAAATCCTCCATCAAAGAAAATAAAGTTATCAGAT GAGCCTGTAGAAGCAAAAGAAGATTACACTAAGTTTAATACTAAAGATTTGAAGACTGAAAAGAAAAAT AGCAAAATGACTGCAGCTCAGAAGGCTTTGGCTAAAGTTGACAAGAGTGGAATGAAAAGTATTGATACC TTTTTTGGGGTAAAAAATAAAAAAAAAATTGGAAAGGTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_024570 |
Insert Size | 939 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_024570.3 |
RefSeq Size | 1691 bp |
RefSeq ORF | 939 bp |
Locus ID | 79621 |
UniProt ID | Q5TBB1 |
Cytogenetics | 13q14.3 |
Protein Pathways | DNA replication |
MW | 35.1 kDa |
Gene Summary | RNase H2 is composed of a single catalytic subunit (A) and two non-catalytic subunits (B and C) and specifically degrades the RNA of RNA:DNA hybrids. The protein encoded by this gene is the non-catalytic B subunit of RNase H2, which is thought to play a role in DNA replication. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Aicardi-Goutieres syndrome type 2 (AGS2). [provided by RefSeq, Nov 2008] Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220946 | RNASEH2B (Myc-DDK-tagged)-Human ribonuclease H2, subunit B (RNASEH2B), transcript variant 1 |
USD 450.00 |
|
RC220946L1 | Lenti ORF clone of Human ribonuclease H2, subunit B (RNASEH2B), transcript variant 1, Myc-DDK-tagged |
USD 750.00 |
|
RC220946L2 | Lenti ORF clone of Human ribonuclease H2, subunit B (RNASEH2B), transcript variant 1, mGFP tagged |
USD 750.00 |
|
RC220946L3 | Lenti ORF clone of Human ribonuclease H2, subunit B (RNASEH2B), transcript variant 1, Myc-DDK-tagged |
USD 750.00 |
|
RC220946L4 | Lenti ORF clone of Human ribonuclease H2, subunit B (RNASEH2B), transcript variant 1, mGFP tagged |
USD 750.00 |
|
RG220946 | RNASEH2B (tGFP-tagged) - Human ribonuclease H2, subunit B (RNASEH2B), transcript variant 1 |
USD 650.00 |
{0} Product Review(s)
Be the first one to submit a review