NRG1 (NM_013958) Human Untagged Clone

CAT#: SC312598

NRG1 (untagged)-Human neuregulin 1 (NRG1), transcript variant HRG-beta3


  "NM_013958" in other vectors (4)

Reconstitution Protocol

USD 480.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


NRG1 mouse monoclonal antibody,clone OTI2C3
    • 100 ul

USD 379.00

Other products for "NRG1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NRG1
Synonyms ARIA; GGF; GGF2; HGL; HRG; HRG1; HRGA; MST131; MSTP131; NDF; NRG1-IT2; SMDF
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_013958, the custom clone sequence may differ by one or more nucleotides
ATGTCCGAGCGCAAAGAAGGCAGAGGCAAAGGGAAGGGCAAGAAGAAGGAGCGAGGCTCC
GGCAAGAAGCCGGAGTCCGCGGCGGGCAGCCAGAGCCCAGCCTTGCCTCCCCGATTGAAA
GAGATGAAAAGCCAGGAATCGGCTGCAGGTTCCAAACTAGTCCTTCGGTGTGAAACCAGT
TCTGAATACTCCTCTCTCAGATTCAAGTGGTTCAAGAATGGGAATGAATTGAATCGAAAA
AACAAACCACAAAATATCAAGATACAAAAAAAGCCAGGGAAGTCAGAACTTCGCATTAAC
AAAGCATCACTGGCTGATTCTGGAGAGTATATGTGCAAAGTGATCAGCAAATTAGGAAAT
GACAGTGCCTCTGCCAATATCACCATCGTGGAATCAAACGAGATCATCACTGGTATGCCA
GCCTCAACTGAAGGAGCATATGTGTCTTCAGAGTCTCCCATTAGAATATCAGTATCCACA
GAAGGAGCAAATACTTCTTCATCTACATCTACATCCACCACTGGGACAAGCCATCTTGTA
AAATGTGCGGAGAAGGAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAA
GACCTTTCAAACCCCTCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGATCGC
TGCCAAAACTACGTAATGGCCAGCTTCTACAGTACGTCCACTCCCTTTCTGTCTCTGCCT
GAA
Restriction Sites Please inquire     
ACCN NM_013958
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013958.1, NP_039252.1
RefSeq Size 1715 bp
RefSeq ORF 726 bp
Locus ID 3084
UniProt ID Q02297
Cytogenetics 8p12
Protein Families Druggable Genome, Secreted Protein, Transcription Factors, Transmembrane
Protein Pathways ErbB signaling pathway
Gene Summary The protein encoded by this gene is a membrane glycoprotein that mediates cell-cell signaling and plays a critical role in the growth and development of multiple organ systems. An extraordinary variety of different isoforms are produced from this gene through alternative promoter usage and splicing. These isoforms are expressed in a tissue-specific manner and differ significantly in their structure, and are classified as types I, II, III, IV, V and VI. Dysregulation of this gene has been linked to diseases such as cancer, schizophrenia, and bipolar disorder (BPD). [provided by RefSeq, Apr 2016]
Transcript Variant: This variant (HRG-beta3), which uses the type I promoter, lacks multiple 3' exons but contains an alternate 3' terminal exon that results in an early stop codon, compared to variant HRG-beta1. The resulting isoform (HRG-beta3, also known as GGF or GGFHFB1) is shorter at the C-terminus, compared to isoform HRG-beta1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.