RASSF1 (NM_170712) Human Untagged Clone

CAT#: SC312380

RASSF1 (untagged)-Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant B

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RASSF1
• Synonyms: 123F2; NORE2A; RASSF1A; RDA32; REH3P21
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC312380 representing NM_170712.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGCTTGAACAAGGACGGTTCTTACACAGGCTTCATCAAGGTTCAGCTGAAGCTGGTGCGCCCTGTC
  TCTGTGCCCTCCAGCAAGAAGCCACCCTCCTTGCAGGATGCCCGGCGGGGCCCAGGACGGGGCACAAGT
  GTCAGGCGCCGCACTTCCTTTTACCTGCCCAAGGATGCTGTCAAGCACCTGCATGTGCTGTCACGCACA
  AGGGCACGTGAAGTCATTGAGGCCCTGCTGCGAAAGTTCTTGGTGGTGGATGACCCCCGCAAGTTTGCA
  CTCTTTGAGCGCGCTGAGCGTCACGGCCAAGTGTACTTGCGGAAGCTGTTGGATGATGAGCAGCCCCTG
  CGGCTGCGGCTCCTGGCAGGGCCCAGTGACAAGGCCCTGAGCTTTGTCCTGAAGGAAAATGACTCTGGG
  GAGGTGAACTGGGACGCCTTCAGCATGCCTGAACTACATAACTTCCTACGTATCCTGCAGCGGGAGGAG
  GAGGAGCACCTCCGCCAGATCCTGCAGAAGTACTCCTATTGCCGCCAGAAGATCCAAGAGGCCCTGCAC
  GCCTGCCCCCTTGGGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_170712
• Insert Size: 570 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_170712.2
• RefSeq Size: 1676 bp
• RefSeq ORF: 570 bp
• Locus ID: 11186
• UniProt ID: Q9NS23
• Cytogenetics: 3p21.31
• Protein Families: Druggable Genome
• Protein Pathways: Bladder cancer, Non-small cell lung cancer, Pathways in cancer
• MW: 21.9 kDa
• Gene Summary: This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011]
  Transcript Variant: This variant (B) differs in the 5' end region compared to variant D. The resulting isoform (B) has a shorter N-terminus, as compared to isoform D. Variants B and H both encode the same isoform (B).