MTMR1 (AK055513) Human Untagged Clone

CAT#: SC311992

(untagged)-Human cDNA FLJ30951 fis, clone HCASM1000115

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MTMR1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for AK055513, the custom clone sequence may differ by one or more nucleotides
  ATGTCCTTTTTTACGTTTAGAATAGTCACCCGAGGGGGGATCAGCTCAACTGTACTGTGG
  GAGAAATTCTTTTCCAACAAACCTCATGCTCGTTTTTCTGTGGTGCAATTTCAAGGGCAA
  CGTGTTCTGTCCTCACCTCACTCTGGTACTCGCCTCTTGGGGCGGCTCAGCCCATTCATG
  GGGATGGCACCAAGCGGCCATGCTCAGTCCTCCAGCCCCGCTGAGGGTAAACCGAGGCCT
  CTGGCAGCTGTGCACAGGTGCTGGCCTCTGGCTCCTTCAAGGAGCACTGCCTGTCACTCG
  CTCCTGGGCTGTCTAGCCATGTCTCCCACCCCCACTTTACCGCAGCCAGCTGCTGGGATC
  AAAGCAAGTCTGTTCTTATGTTATTTGCCTGTA
  
• Restriction Sites: Please inquire
• ACCN: AK055513
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: AK055513.1
• RefSeq Size: 2128 bp
• RefSeq ORF: 2128 bp
• Locus ID: 8776
• Cytogenetics: Xq28
• Protein Families: Druggable Genome, Phosphatase
• Protein Pathways: Fructose and mannose metabolism, Metabolic pathways, Riboflavin metabolism, Thiamine metabolism
• Gene Summary: This gene encodes a member of the myotubularin related family of proteins. Members of this family contain the consensus sequence for the active site of protein tyrosine phosphatases. Alternatively spliced variants have been described but their biological validity has not been determined. [provided by RefSeq, Jul 2008]