ENTR1 (NM_001039708) Human Untagged Clone

CAT#: SC310822

SDCCAG3 (untagged)-Human serologically defined colon cancer antigen 3 (SDCCAG3), transcript variant 3


  "NM_001039708" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Anti-SDCCAG3 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "ENTR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ENTR1
Synonyms NY-CO-3; SDCCAG3; SDDAG3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310822 representing NM_001039708.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGGGCTACCAGCGCCGCCCGGGCGCCACCCCGCTGTCCCGAGCCCGGAGCCTCGCCATTCCCGAC
GATGACAGATTTGAAGATCTGGAAGAGGCAAATCCATTCTCTTTTAGAGAGTTTCTGAAGACCAAGAAC
CTCGGCCTCTCGAAAGAGGATCCGGCCAGCAGAATTTATGCAAAGGAAGCCTCGAGGCATTCCCTGGGA
CTTGACCACAACTCCCCACCCTCCCAAACCGGCGGGTATGGCCTGGAGTATCAGCAGCCATTTTTCGAG
GATCCGACAGGGGCTGGTGACCTCCTGGATGAGGAGGAGGATGAGGACACCGGATGGAGTGGGGCCTAC
CTGCCGTCCGCCATCGAGCAGACTCACCCCGAGAGGGTCCCTGCCGGCACGTCGCCCTGCAGCACATAC
CTTTCCTTTTTCTCCACCCCGTCGGAGCTGGCAGGGCCTGAGTCTCTGCCCTCGTGGGCGTTGAGTGAC
ACTGATTCTCGCGTGTCTCCGGCCTCTCCGGCAGGGAGTCCTAGCGCAGACTTTGCGGTTCATGGAGAG
TCTCTGGGAGACAGGCACCTGCGGACGCTGCAGATAAGTTACGACGCACTGAAAGATGAAAATTCTAAG
CTGAGAAGAAAGCTGAATGAGGTTCAGAGCTTCTCTGAAGCTCAAACAGAAATGGTGAGGACGCTTGAG
CGGAAGTTAGAAGCAAAAATGATCAAGGAGGAAAGCGACTACCACGACCTGGAGTCGGTGGTTCAGCAG
GTGGAGCAGAACCTGGAGCTGATGACCAAACGGGCTGTAAAGGCAGAAAACCACGTCGTGAAACTAAAA
CAGGAAATCAGTTTGCTCCAGGCGCAGGTCTCCAACTTCCAGCGAGAGAATGAAGCCCTGCGGTGCGGC
CAGGGTGCCAGCCTGACCGTGGTGAAGCAGAACGCCGACGTGGCCCTGCAGAACCTCCGGGTGGTCATG
AACAGTGCACAGGCTTCCATCAAGCAACTGGTTTCCGGAGCTGAGACACTGAATCTTGTTGCCGAAATC
CTTAAATCTATAGACAGAATTTCTGAAGTTAAAGACGAGGAGGAAGACTCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001039708
Insert Size 1089 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001039708.1
RefSeq Size 2171 bp
RefSeq ORF 1089 bp
Locus ID 10807
UniProt ID Q96C92
Cytogenetics 9q34.3
MW 40.1 kDa
Gene Summary Endosome-associated protein that plays a role in membrane receptor sorting, cytokinesis and ciliogenesis (PubMed:23108400, PubMed:25278552, PubMed:27767179). Involved in the endosome-to-plasma membrane trafficking and recycling of SNX27-retromer-dependent cargo proteins, such as GLUT1 (PubMed:25278552). Involved in the regulation of cytokinesis; the function may involve PTPN13 and GIT1 (PubMed:23108400). Plays a role in the formation of cilia (PubMed:27767179). Involved in cargo protein localization, such as PKD2, at primary cilia (PubMed:27767179). Involved in the presentation of the tumor necrosis factor (TNF) receptor TNFRSF1A on the cell surface, and hence in the modulation of the TNF-induced apoptosis (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks two alternate in-frame exons in the 5' end compared to variant 1. The resulting isoform (3) has the same N- and C-termini but is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.