MCP2 (CCL8) (NM_005623) Human Untagged Clone
CAT#: SC310690
CCL8 (untagged)-Human chemokine (C-C motif) ligand 8 (CCL8)
"NM_005623" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MCP2 |
Synonyms | HC14; MCP-2; MCP2; SCYA8; SCYA10 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_005623 edited
CCTTCAGCCTCTGCTCCACAGAGCCTAAGCAAAAGATAGAAACTCACAACTTCCTTGTTT TGTTATCTGGAAATTATCCCAGGATCTGGTGCTTACTCAGCATATTCAAGGAAGGTCTTA CTTCATTCTTCCTTGATTGTGACCATGCCCAGGCTCTCTGCTCCCTATAAAAGGCAGGCA GAGCCACCGAGGAGCAGAGAGGTTGAGAACAACCCAGAAACCTTCACCTCTCATGCTGAA GCTCACACCCTTGCCCTCCAAGATGAAGGTTTCTGCAGCGCTTCTGTGCCTGCTGCTCAT GGCAGCCACTTTCAGCCCTCAGGGACTTGCTCAGCCAGATTCAGTTTCCATTCCAATCAC CTGCTGCTTTAACGTGATCAATAGGAAAATTCCTATCCAGAGGCTGGAGAGCTACACAAG AATCACCAACATCCAATGTCCCAAGGAAGCTGTGATCTTCAAGACCCAACGGGGCAAGGA GGTCTGTGCTGACCCCAAGGAGAGATGGGTCAGGGATTCCATGAAGCATCTGGACCAAAT ATTTCAAAATCTGAAGCCATGAGCCTTCATACATGGACTGAGAGTCAGAGCTTGAAGAAA AGCTTATTTATTTTCCCCAACCTCCCCC |
Restriction Sites | Please inquire |
ACCN | NM_005623 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_005623.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005623.2, NP_005614.2 |
RefSeq Size | 1351 bp |
RefSeq ORF | 300 bp |
Locus ID | 6355 |
UniProt ID | P80075 |
Cytogenetics | 17q12 |
Domains | IL8 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction, NOD-like receptor signaling pathway |
Gene Summary | This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes, lymphocytes, basophils and eosinophils. By recruiting leukocytes to sites of inflammation this cytokine may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. [provided by RefSeq, Sep 2014] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221610 | CCL8 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 8 (CCL8) |
USD 150.00 |
|
RC221610L3 | Lenti ORF clone of Human chemokine (C-C motif) ligand 8 (CCL8), Myc-DDK-tagged |
USD 450.00 |
|
RC221610L4 | Lenti ORF clone of Human chemokine (C-C motif) ligand 8 (CCL8), mGFP tagged |
USD 450.00 |
|
RG221610 | CCL8 (tGFP-tagged) - Human chemokine (C-C motif) ligand 8 (CCL8) |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review