C1D (NM_173177) Human Untagged Clone
CAT#: SC310671
C1D (untagged)-Human C1D nuclear receptor corepressor (C1D), transcript variant 2
"NM_173177" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | C1D |
Synonyms | hC1D; LRP1; Rrp47; SUN-CoR; SUNCOR |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310671 representing NM_173177.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAGGTGAAGAAATTAATGAAGACTATCCAGTAGAAATTCACGAGTATTTGTCAGCGTTTGAGAAT TCCATTGGTGCTGTGGATGAGATGCTGAAGACCATGATGTCTGTTTCTAGAAATGAGTTGTTGCAGAAG TTGGATCCACTTGAACAAGCAAAAGTGGATTTGGTTTCTGCATACACATTAAATTCAATGTTTTGGGTT TATTTGGCAACCCAAGGAGTTAATCCTAAGGAACATCCAGTAAAACAGGAATTGGAAAGAATCAGAGTA TATATGAACAGAGTCAAGGAAATAACAGACAAGAAAAAGGCTGGCAAGCTGGACAGAGGTGCAGCTTCA AGATTTGTAAAAAATGCCCTCTGGGAACCAAAATCGAAAAATGCATCAAAAGTTGCCAATAAAGGAAAA AGTAAAAGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_173177 |
Insert Size | 426 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_173177.2 |
RefSeq Size | 1194 bp |
RefSeq ORF | 426 bp |
Locus ID | 10438 |
UniProt ID | Q13901 |
Cytogenetics | 2p14 |
Protein Families | Druggable Genome |
Protein Pathways | RNA degradation |
MW | 16 kDa |
Gene Summary | The protein encoded by this gene is a DNA binding and apoptosis-inducing protein and is localized in the nucleus. It is also a Rac3-interacting protein which acts as a corepressor for the thyroid hormone receptor. This protein is thought to regulate TRAX/Translin complex formation. Alternate splicing results in multiple transcript variants that encode the same protein. Multiple pseudogenes of this gene are found on chromosome 10.[provided by RefSeq, Jun 2010] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3 and 4 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203301 | C1D (Myc-DDK-tagged)-Human C1D nuclear receptor corepressor (C1D), transcript variant 2 |
USD 150.00 |
|
RC203301L3 | Lenti ORF clone of Human C1D nuclear receptor corepressor (C1D), transcript variant 2, Myc-DDK-tagged |
USD 450.00 |
|
RC203301L4 | Lenti ORF clone of Human C1D nuclear receptor corepressor (C1D), transcript variant 2, mGFP tagged |
USD 450.00 |
|
RG203301 | C1D (tGFP-tagged) - Human C1D nuclear receptor corepressor (C1D), transcript variant 2 |
USD 350.00 |
|
SC321081 | C1D (untagged)-Human C1D nuclear receptor corepressor (C1D), transcript variant 2 |
USD 150.00 |
{0} Product Review(s)
Be the first one to submit a review