GPR40(FFAR1) (NM_005303) Human Untagged Clone

CAT#: SC310553

TrueClone®, FFAR1 (untagged)-Human free fatty acid receptor 1 (FFAR1)

USD 618.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GPR40(FFAR1) (NM_005303) Human Untagged Clone
Symbol FFAR1
Synonyms FFA1R; GPCR40; GPR40
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_005303 edited
ATGGACCTGCCCCCGCAGCTCTCCTTCGGCCTCTATGTGGCCGCCTTTGCGCTGGGCTTC
CCGCTCAACGTCCTGGCCATCCGAGGCGCGACGGCCCACGCCCGGCTCCGTCTCACCCCT
AGCCTGGTCTACGCCCTGAACCTGGGCTGCTCCGACCTGCTGCTGACAGTCTCTCTGCCC
CTGAAGGCGGTGGAGGCGCTAGCCTCCGGGGCCTGGCCTCTGCCGGCCTCGCTGTGCCCC
GTCTTCGCGGTGGCCCACTTCTTCCCACTCTATGCCGGCGGGGGCTTCCTGGCCGCCCTG
AGTGCAGGCCGCTACCTGGGAGCAGCCTTCCCCTTGGGCTACCAAGCCTTCCGGAGGCCG
TGCTATTCCTGGGGGGTGTGCGCGGCCATCTGGGCCCTCGTCCTGTGTCACCTGGGTCTG
GTCTTTGGGTTGGAGGCTCCAGGAGGCTGGCTGGACCACAGCAACACCTCCCTGGGCATC
AACACACCGGTCAACGGCTCTCCGGTCTGCCTGGAGGCCTGGGACCCGGCCTCTGCCGGC
CCGGCCCGCTTCAGCCTCTCTCTCCTGCTCTTTTTTCTGCCCTTGGCCATCACAGCCTTC
TGCTACGTGGGCTGCCTCCGGGCACTGGCCCACTCCGGCCTGACGCACAGGCGGAAGCTG
CGGGCCGCCTGGGTGGCCGGCGGGGCCCTCCTCACGCTGCTGCTCTGCGTAGGACCCTAC
AACGCCTCCAACGTGGCCAGCTTCCTGTACCCCAATCTAGGAGGCTCCTGGCGGAAGCTG
GGGCTCATCACGGGTGCCTGGAGTGTGGTGCTTAATCCGCTGGTGACCGGTTACTTGGGA
AGGGGTCCTGGCCTGAAGACAGTGTGTGCGGCAAGAACGCAAGGGGGCAAGTCCCAGAAG
TAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005303 unedited
GGCAGTCANAATTTGTATACGACTCACTATAGGCGGCCGCATCTAGATCGAGACTAGTTC
CAGGGCTGGAACCCGCGAGTGATCCCAGGAGCCCCTCCTCTCCGGGGCCCCAAGATCTGA
GGACAGGGAGCCAGGTTGCACACAGGAGCCGTGCAGGCCAGGACGGCGGCCCCATGGACC
TGCCCCCGCAGCTCTCCTTCGGCCTCTATGTGGCCGCCTTTGCGCTGGGCTTCCCGCTCA
ACGTCCTGGCCATCCGAGGCGCGACGGCCCACGCCCGGCTCCGTCTCACCCCTAGCCTGG
TCTACGCCCTGAACCTGGGCTGCTCCGACCTGCTGCTGACAGTCTCTCTGCCCCTGAAGG
CGGTGGAGGCGCTAGCCTCCGGGGCCTGGCCTCTGCCGGCCTCGCTGTGCCCCGTCTTCG
CGGTGGCCCACTTCTTCCCACTCTATGCCGGCGGGGGCTTCCTGGCCGCCCTGAGTGCAG
GCCGCTACCTGGGAGCAGCCTTCCCCTTGGGCTACCAAGCCTTCCGGAGGCCGTGCTATT
CCTGGGGGGGTGTGCGCGGCCATCTGGGCCCTCGTCCTGTGTCACCTGGGTCTGGTCTTT
GGGTTGGAGGCTCCAGGAGGCTGGCTGGACCACAGCAACACCTCCCTGGGCATCAACACA
CCGGTCAACGGCTCTCCGGTCTGCCTGGAGGCCTGGGACCCGGCCTCTGCCGGCCCGGCC
CGCTTCAGCCTCTCTCTCCTGCTCTTTTTTCTGCCCTTGGCCATCACAGCCTTCTGCTAC
GTGGGCTGCCTCCGGGCACTGGCCCACTCCGGCCTGACGCACAGGGCGGAAACTGCGGGC
CGNCTGGGTGGCCGGGCGGGGCCCTCCTCACGCTGCTGCTCTGCGGTAGACCTTACAAGC
CTCCAAGTGGGCCGCTTCCTGTCT
3' Read Nucleotide Sequence
>Forward primer walk for NM_005303 unedited
TACATAGGCTCTCCGTNTGCCTGGNAGCCTGGGNACCGGCCTCTGCCGGCCCGGCCCGCT
TCAGCCTCTCTCTCCTGCTCTTTTTTCTGCCCTTGGCCATCACAGCCTTCTGCTACGTGG
GCTGCCTCCGGGCACTGGCCCACTCCGGCCTGACGCACAGGCGGAAGCTGCGGGCCGCCT
GGGTGGCCGGCGGGGCCCTCCTCACGCTGCTGCTCTGCGTAGGACCCTACAACGCCTCCA
ACGTGGCCAGCTTCCTGTACCCCAATCTAGGAGGCTCCTGGCGGAAGCTGGGGCTCATCA
CGGGTGCCTGGAGTGTGGTGCTTAATCCGCTGGTGACCGGTTACTTGGGAAGGGGTCCTG
GCCTGAAGACAGTGTGTGCGGCAAGAACGCAAGGGGGCAAGTCCCAGAAGTAACGCCACT
GCTCGGGGGAAGGAGCATGGGGCAGGAGGGCCCGGCTGCTTCTCCAGGCCCCTGCGGGGG
GCTGCTTCGGAGGAACTGCAGGGCAGCCTGGCCCGGAGGCCTCCCTGGAGCCACTCAAGC
AGAGAGCGGCGCCTGCTGAGGGCAGCACCCCAGTCAAGAGAGGAGCACCGAGCCAGAGCA
CGGTGGCAGGGGGAGGTAAGTTTGCCCCTGCACGTGTCGAGGAAGTTTGTCCCTTCCTCG
CCTATCTTTCTCTCCCCTCTGCACGTCCTCACCTGCCTGTCTTCCGTGGGCCGCGAGCAG
AGGCCTTGTACTTACGGGAAGGGAGGAGCAGTCTGTTTCTGACCCACNAGAACTGCCACT
CCGGGTGATGCACTTTGAGGACAGCTACTCTGGAATCAGTTCCCCAGGAGAAACATTTGA
TTTCCGAGTAGGGAGAGAC
Tag Tag Free
ACCN NM_005303
ORF Size 903 bp
Insert Size 1300
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005303.1, NP_005294
RefSeq Size 903
RefSeq ORF 903
Locus ID 2864
Cytogenetics 19q13.12
Domains 7tm_1
Protein Families GPCR, Transmembrane, Druggable Genome
Gene Summary This gene encodes a member of the GP40 family of G protein-coupled receptors that are clustered together on chromosome 19. The encoded protein is a receptor for medium and long chain free fatty acids and may be involved in the metabolic regulation of insulin secretion. Polymorphisms in this gene may be associated with type 2 diabetes. [provided by RefSeq, Apr 2009]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.