Eph receptor A6 (EPHA6) (NM_173655) Human Untagged Clone

CAT#: SC309198

EPHA6 (untagged)-Human EPH receptor A6 (EPHA6), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Eph receptor A6
• Synonyms: EHK-2; EHK2; EK12; EPA6; HEK12; PRO57066
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC309198 representing NM_173655.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAAAGACTCTCCATTTCAAGTGACAAAACTGTACTGGCTTAATGAAAAGTGGGACTTTATTGCCTCA
  GCTTCTGACATGGCAGCAGAACAAGGACAGATTCTCGTGATAGCCACCGCCGCTGTTGGCGGATTCACT
  CTCCTCGTCATCCTCACTTTATTCTTCTTGATCACTGGGAGATGTCAGTGGTACATAAAAGCCAAGATG
  AAGTCAGAAGAGAAGAGAAGAAACCACTTACAGAATGGGCATTTGCGCTTCCCGGGAATTAAAACTTAC
  ATTGATCCAGATACATATGAAGACCCATCCCTAGCAGTCCATGAATTTGCAAAGGAGATTGATCCCTCA
  AGAATTCGTATTGAGAGAGTCATTGGGGCAGGTGAATTTGGAGAAGTCTGTAGTGGGCGTTTGAAGACA
  CCAGGGAAAAGAGAGATCCCAGTTGCCATTAAAACTTTGAAAGGTGGCCACATGGATCGGCAAAGAAGA
  GATTTTCTAAGAGAAGCTAGTATCATGGGCCAGTTTGACCATCCAAACATCATTCGCCTAGAAGGGGTT
  GTCACCAAAAGATCCTTCCCGGCCATTGGGGTGGAGGCGTTTTGCCCCAGCTTCCTGAGGGCAGGGTTT
  TTAAATAGCATCCAGGCCCCGCATCCAGTGCCAGGGGGAGGATCTTTGCCCCCCAGGATTCCTGCTGGC
  AGACCAGTAATGATTGTGGTGGAATATATGGAGAATGGATCCCTAGACTCCTTTTTGCGGAAGCATGAT
  GGCCACTTCACAGTCATCCAGTTGGTCGGAATGCTCCGAGGCATTGCATCAGGCATGAAGTATCTTTCT
  GATATGGGTTATGTTCATCGAGACCTAGCGGCTCGGAATATACTGGTCAATAGCAACTTAGTATGCAAA
  GTTTCTGATTTTGGTCTCTCCAGAGTGCTGGAAGATGATCCAGAAGCTGCTTATACAACAACTGACCTC
  TTCCAAACTCTAACACTTAACCTCTGCTATTCTGCATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_173655
• Insert Size: 1005 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_173655.1
• RefSeq Size: 1670 bp
• RefSeq ORF: 1005 bp
• Locus ID: 285220
• UniProt ID: Q9UF33
• Cytogenetics: 3q11.2
• Protein Families: Druggable Genome, Protein Kinase, Transmembrane
• Protein Pathways: Axon guidance
• MW: 37.3 kDa
• Gene Summary: Receptor tyrosine kinase which binds promiscuously GPI-anchored ephrin-A family ligands residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) contains multiple differences at the 5' and 3' ends, compared to variant 1. It represents use of an alternate promoter and initiates translation at an alternate start codon. The encoded isoform (b) is shorter and has distinct N- and C- termini, compared to isoform a.