Wilms Tumor Protein(WT1) (NM_024426) Human Untagged Clone

CAT#: SC308799

WT1 (untagged)-Human Wilms tumor 1 (WT1), transcript variant D

USD 824


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Wilms Tumor Protein(WT1) (NM_024426) Human Untagged Clone
Symbol WT1
Synonyms AWT1; EWS-WT1; GUD; NPHS4; WAGR; WIT-2; WT33
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_024426 edited
CTGCAGGACCCGGCTTCCACGTGTGTCCCGGAGCCGGCGTCTCAGCACACGCTCCGCTCC
GGGCCTGGGTGCCTACAGCAGCCAGAGCAGCAGGGAGTCCGGGACCCGGGCGGCATCTGG
GCCAAGTTAGGCGCCGCCGAGGCCAGCGCTGAACGTCTCCAGGGCCGGAGGAGCCGCGGG
GCGTCCGGGTCTGAGCCGCAGCAAATGGGCTCCGACGTGCGGGACCTGAACGCGCTGCTG
CCCGCCGTCCCCTCCCTGGGTGGCGGCGGCGGCTGTGCCCTGCCTGTGAGCGGCGCGGCG
CAGTGGGCGCCGGTGCTGGACTTTGCGCCCCCGGGCGCTTCGGCTTACGGGTCGTTGGGC
GGCCCCGCGCCGCCACCGGCTCCGCCGCCACCCCCGCCGCCGCCGCCTCACTCCTTCATC
AAACAGGAGCCGAGCTGGGGCGGCGCGGAGCCGCACGAGGAGCAGTGCCTGAGCGCCTTC
ACTGTCCACTTTTCCGGCCAGTTCACTGGCACAGCCGGAGCCTGTCGCTACGGGCCCTTC
GGTCCTCCTCCGCCCAGCCAGGCGTCATCCGGCCAGGCCAGGATGTTTCCTAACGCGCCC
TACCTGCCCAGCTGCCTCGAGAGCCAGCCCGCTATTCGCAATCAGGGTTACAGCACGGTC
ACCTTCGACGGGACGCCCAGCTACGGTCACACGCCCTCGCACCATGCGGCGCAGTTCCCC
AACCACTCATTCAAGCATGAGGATCCCATGGGCCAGCAGGGCTCGCTGGGTGAGCAGCAG
TACTCGGTGCCGCCCCCGGTCTATGGCTGCCACACCCCCACCGACAGCTGCACCGGCAGC
CAGGCTTTGCTGCTGAGGACGCCCTACAGCAGTGACAATTTATACCAAATGACATCCCAG
CTTGAATGCATGACCTGGAATCAGATGAACTTAGGAGCCACCTTAAAGGGAGTTGCTGCT
GGGAGCTCCAGCTCAGTGAAATGGACAGAAGGGCAGAGCAACCACAGCACAGGGTACGAG
AGCGATAACCACACAACGCCCATCCTCTGCGGAGCCCAATACAGAATACACACGCACGGT
GTCTTCAGAGGCATTCAGGATGTGCGACGTGTGCCTGGAGTAGCCCCGACTCTTGTACGG
TCGGCATCTGAGACCAGTGAGAAACGCCCCTTCATGTGTGCTTACCCAGGCTGCAATAAG
AGATATTTTAAGCTGTCCCACTTACAGATGCACAGCAGGAAGCACACTGGTGAGAAACCA
TACCAGTGTGACTTCAAGGACTGTGAACGAAGGTTTTCTCGTTCAGACCAGCTCAAAAGA
CACCAAAGGAGACATACAGGTGTGAAACCATTCCAGTGTAAAACTTGTCAGCGAAAGTTC
TCCCGGTCCGACCACCTGAAGACCCACACCAGGACTCATACAGGTAAAACAAGTGAAAAG
CCCTTCAGCTGTCGGTGGCCAAGTTGTCAGAAAAAGTTTGCCCGGTCAGATGAATTAGTC
CGCCATCACAACATGCATCAGAGAAACATGACCAAACTCCAGCTGGCGCTTTGA
Tag Tag Free
ACCN NM_024426
ORF Size 1554 bp
Insert Size 3000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_024426.3, NP_077744
RefSeq Size 3029
RefSeq ORF 1554
Locus ID 7490
Cytogenetics 11p13
Domains WT1, zf-C2H2
Protein Families Transcription Factors, Druggable Genome
Gene Summary This gene encodes a transcription factor that contains four zinc-finger motifs at the C-terminus and a proline/glutamine-rich DNA-binding domain at the N-terminus. It has an essential role in the normal development of the urogenital system, and it is mutated in a small subset of patients with Wilms tumor. This gene exhibits complex tissue-specific and polymorphic imprinting pattern, with biallelic, and monoallelic expression from the maternal and paternal alleles in different tissues. Multiple transcript variants have been described. In several variants, there is evidence for the use of a non-AUG (CUG) translation initiation codon upstream of, and in-frame with the first AUG. Authors of PMID:7926762 also provide evidence that WT1 mRNA undergoes RNA editing in human and rat, and that this process is tissue-restricted and developmentally regulated. [provided by RefSeq, Mar 2015].
Transcript Variant: This variant (D) represents the longest transcript and encodes the longest isoform (D). It initiates translation from a non-AUG (CUG) site, and also from a downstream, in-frame AUG.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.