NOTCH2 (NM_024408) Human Untagged Clone

CAT#: SC308798

NOTCH2 (untagged)-Human notch 2 (NOTCH2), transcript variant 1

USD 4,718.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name NOTCH2 (NM_024408) Human Untagged Clone
Symbol NOTCH2
Synonyms AGS2; HJCYS; hN2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_024408 edited
GAGGCGGCGGCCGAGGAGCGGCGGACTCGGGGCGCGGGGAGTCGAGGCATTTGCGCCTGG
GCTTCGGAGCGTAGCGCCAGGGCCTGAGCCTTTGAAGCAGGAGGAGGGGAGGAGAGAGTG
GGGCTCCTCTATCGGGACCCCCTCCCCATGTGGATCTGCCCAGGCGGCGGCGGCGGCGGC
GGAGGAGGAGGCGACCGAGAAGATGCCCGCCCTGCGCCCCGCTCTGCTGTGGGCGCTGCT
GGCGCTCTGGCTGTGCTGCGCGGCCCCCGCGCATGCATTGCAGTGTCGAGATGGCTATGA
ACCCTGTGTAAATGAAGGAATGTGTGTTACCTACCACAATGGCACAGGATACTGCAAATG
TCCAGAAGGCTTCTTGGGGGAATATTGTCAACATCGAGACCCCTGTGAGAAGAACCGCTG
CCAGAATGGTGGGACTTGTGTGGCCCAGGCCATGCTGGGGAAAGCCACGTGCCGATGTGC
CTCAGGGTTTACAGGAGAGGACTGCCAGTACTCAACATCTCATCCATGCTTTGTGTCTCG
ACCCTGCCTGAATGGCGGCACATGCCATATGCTCAGCCGGGATACCTATGAGTGCACCTG
TCAAGTCGGGTTTACAGGTAAGGAGTGCCAATGGACGGATGCCTGCCTGTCTCATCCCTG
TGCAAATGGAAGTACCTGTACCACTGTGGCCAACCAGTTCTCCTGCAAATGCCTCACAGG
CTTCACAGGGCAGAAATGTGAGACTGATGTCAATGAGTGTGACATTCCAGGACACTGCCA
GCATGGTGGCACCTGCCTCAACCTGCCTGGTTCCTACCAGTGCCAGTGCCCTCAGGGCTT
CACAGGCCAGTACTGTGACAGCCTGTATGTGCCCTGTGCACCCTCACCTTGTGTCAATGG
AGGCACCTGTCGGCAGACTGGTGACTTCACTTTTGAGTGCAACTGCCTTCCAGGTTTTGA
AGGGAGCACCTGTGAGAGGAATATTGATGACTGCCCTAACCACAGGTGTCAGAATGGAGG
GGTTTGTGTGGATGGGGTCAACACTTACAACTGCCGCTGTCCCCCACAATGGACAGGACA
GTTCTGCACAGAGGATGTGGATGAATGCCTGCTGCAGCCCAATGCCTGTCAAAATGGGGG
CACCTGTGCCAACCGCAATGGAGGCTATGGCTGTGTATGTGTCAACGGCTGGAGTGGAGA
TGACTGCAGTGAGAACATTGATGATTGTGCCTTCGCCTCCTGTACTCCAGGCTCCACCTG
CATCGACCGTGTGGCCTCCTTCTCTTGCATGTGCCCAGAGGGGAAGGCAGGTCTCCTGTG
TCATCTGGATGATGCATGCATCAGCAATCCTTGCCACAAGGGGGCACTGTGTGACACCAA
CCCCCTAAATGGGCAATATATTTGCACCTGCCCACAAGGCTACAAAGGGGCTGACTGCAC
AGAAGATGTGGATGAATGTGCCATGGCCAATAGCAATCCTTGTGAGCATGCAGGAAAATG
TGTGAACACGGATGGCGCCTTCCACTGTGAGTGTCTGAAGGGTTATGCAGGACCTCGTTG
TGAGATGGACATCAATGAGTGCCATTCAGACCCCTGCCAGAATGATGCTACCTGTCTGGA
TAAGATTGGAGGCTTCACATGTCTGTGCATGCCAGGTTTCAAAGGTGTGCATTGTGAATT
AGAAATAAATGAATGTCAGAGCAACCCTTGTGTGAACAATGGGCAGTGTGTGGATAAAGT
CAATCGTTTCCAGTGCCTGTGTCCTCCTGGTTTCACTGGGCCAGTTTGCCAGATTGATAT
TGATGACTGTTCCAGTACTCCGTGTCTGAATGGGGCAAAGTGTATCGATCACCCGAATGG
CTATGAATGCCAGTGTGCCACAGGTTTCACTGGTGTGTTGTGTGAGGAGAACATTGACAA
CTGTGACCCCGATCCTTGCCACCATGGTCAGTGTCAGGATGGTATTGATTCCTACACCTG
CATCTGCAATCCCGGGTACATGGGCGCCATCTGCAGTGACCAGATTGATGAATGTTACAG
CAGCCCTTGCCTGAACGATGGTCGCTGCATTGACCTGGTCAATGGCTACCAGTGCAACTG
CCAGCCAGGCACGTCAGGGGTTAATTGTGAAATTAATTTTGATGACTGTGCAAGTAACCC
TTGTATCCATGGAATCTGTATGGATGGCATTAATCGCTACAGTTGTGTCTGCTCACCAGG
ATTCACAGGGCAGAGATGTAACATTGACATTGATGAGTGTGCCTCCAATCCCTGTCGCAA
GGGTGCAACATGTATCAACGGTGTGAATGGTTTCCGCTGTATATGCCCCGAGGGACCCCA
TCACCCCAGCTGCTACTCACAGGTGAACGAATGCCTGAGCAATCCCTGCATCCATGGAAA
CTGTACTGGAGGTCTCAGTGGATATAAGTGTCTCTGTGATGCAGGCTGGGTTGGCATCAA
CTGTGAAGTGGACAAAAATGAATGCCTTTCGAATCCATGCCAGAATGGAGGAACTTGTGA
CAATCTGGTGAATGGATACAGGTGTACTTGCAAGAAGGGCTTTAAAGGCTATAACTGCCA
GGTGAATATTGATGAATGTGCCTCAAATCCATGCCTGAACCAAGGAACCTGCTTTGATGA
CATAAGTGGCTACACTTGCCACTGTGTGCTGCCATACACAGGCAAGAATTGTCAGACAGT
ATTGGCTCCCTGTTCCCCAAACCCTTGTGAGAATGCTGCTGTTTGCAAAGAGTCACCAAA
TTTTGAGAGTTATACTTGCTTGTGTGCTCCTGGCTGGCAAGGTCAGCGGTGTACCATTGA
CATTGACGAGTGTATCTCCAAGCCCTGCATGAACCATGGTCTCTGCCATAACACCCAGGG
CAGCTACATGTGTGAATGTCCACCAGGCTTCAGTGGTATGGACTGTGAGGAGGACATTGA
TGACTGCCTTGCCAATCCTTGCCAGAATGGAGGTTCCTGTATGGATGGAGTGAATACTTT
CTCCTGCCTCTGCCTTCCGGGTTTCACTGGGGATAAGTGCCAGACAGACATGAATGAGTG
TCTGAGTGAACCCTGTAAGAATGGAGGGACCTGCTCTGACTACGTCAACAGTTACACTTG
CAAGTGCCAGGCAGGATTTGATGGAGTCCATTGTGAGAACAACATCAATGAGTGCACTGA
GAGCTCCTGTTTCAATGGTGGCACATGTGTTGATGGGATTAACTCCTTCTCTTGCTTGTG
CCCTGTGGGTTTCACTGGATCCTTCTGCCTCCATGAGATCAATGAATGCAGCTCTCATCC
ATGCCTGAATGAGGGAACGTGTGTTGATGGCCTGGGTACCTACCGCTGCAGCTGCCCCCT
GGGCTACACTGGGAAAAACTGTCAGACCCTGGTGAATCTCTGCAGTCGGTCTCCATGTAA
AAACAAAGGTACTTGCGTTCAGAAAAAAGCAGAGTCCCAGTGCCTATGTCCATCTGGATG
GGCTGGTGCCTATTGTGACGTGCCCAATGTCTCTTGTGACATAGCAGCCTCCAGGAGAGG
TGTGCTTGTTGAACACTTGTGCCAGCACTCAGGTGTCTGCATCAATGCTGGCAACACGCA
TTACTGTCAGTGCCCCCTGGGCTATACTGGGAGCTACTGTGAGGAGCAACTCGATGAGTG
TGCGTCCAACCCCTGCCAGCACGGGGCAACATGCAGTGACTTCATTGGTGGATACAGATG
CGAGTGTGTCCCAGGCTATCAGGGTGTCAACTGTGAGTATGAAGTGGATGAGTGCCAGAA
TCAGCCCTGCCAGAATGGAGGCACCTGTATTGACCTTGTGAACCATTTCAAGTGCTCTTG
CCCACCAGGCACTCGGGGCCTACTCTGTGAAGAGAACATTGATGACTGTGCCCGGGGTCC
CCATTGCCTTAATGGTGGTCAGTGCATGGATAGGATTGGAGGCTACAGTTGTCGCTGCTT
GCCTGGCTTTGCTGGGGAGCGTTGTGAGGGAGACATCAACGAGTGCCTCTCCAACCCCTG
CAGCTCTGAGGGCAGCCTGGACTGTATACAGCTCACCAATGACTACCTGTGTGTTTGCCG
TAGTGCCTTTACTGGCCGGCACTGTGAAACCTTCGTCGATGTGTGTCCCCAGATGCCCTG
CCTGAATGGAGGGACTTGTGCTGTGGCCAGTAACATGCCTGATGGTTTCATTTGCCGTTG
TCCCCCGGGATTTTCCGGGGCAAGGTGCCAGAGCAGCTGTGGACAAGTGAAATGTAGGAA
GGGGGAGCAGTGTGTGCACACCGCCTCTGGACCCCGCTGCTTCTGCCCCAGTCCCCGGGA
CTGCGAGTCAGGCTGTGCCAGTAGCCCCTGCCAGCACGGGGGCAGCTGCCACCCTCAGCG
CCAGCCTCCTTATTACTCCTGCCAGTGTGCCCCACCATTCTCGGGTAGCCGCTGTGAACT
CTACACGGCACCCCCCAGCACCCCTCCTGCCACCTGTCTGAGCCAGTATTGTGCCGACAA
AGCTCGGGATGGCGTCTGTGATGAGGCCTGCAACAGCCATGCCTGCCAGTGGGATGGGGG
TGACTGTTCTCTCACCATGGAGAACCCCTGGGCCAACTGCTCCTCCCCACTTCCCTGCTG
GGATTATATCAACAACCAGTGTGATGAGCTGTGCAACACGGTCGAGTGCCTGTTTGACAA
CTTTGAATGCCAGGGGAACAGCAAGACATGCAAGTATGACAAATACTGTGCAGACCACTT
CAAAGACAACCACTGTGACCAGGGGTGCAACAGTGAGGAGTGTGGTTGGGATGGGCTGGA
CTGTGCTGCTGACCAACCTGAGAACCTGGCAGAAGGTACCCTGGTTATTGTGGTATTGAT
GCCACCTGAACAACTGCTCCAGGATGCTCGCAGCTTCTTGCGGGCACTGGGTACCCTGCT
CCACACCAACCTGCGCATTAAGCGGGACTCCCAGGGGGAACTCATGGTGTACCCCTATTA
TGGTGAGAAGTCAGCTGCTATGAAGAAACAGAGGATGACACGCAGATCCCTTCCTGGTGA
ACAAGAACAGGAGGTGGCTGGCTCTAAAGTCTTTCTGGAAATTGACAACCGCCAGTGTGT
TCAAGACTCAGACCACTGCTTCAAGAACACGGATGCAGCAGCAGCTCTCCTGGCCTCTCA
CGCCATACAGGGGACCCTGTCATACCCTCTTGTGTCTGTCGTCAGTGAATCCCTGACTCC
AGAACGCACTCAGCTCCTCTATCTCCTTGCTGTTGCTGTTGTCATCATTCTGTTTATTAT
TCTGCTGGGGGTAATCATGGCAAAACGAAAGCGTAAGCATGGCTCTCTCTGGCTGCCTGA
AGGTTTCACTCTTCGCCGAGATGCAAGCAATCACAAGCGTCGTGAGCCAGTGGGACAGGA
TGCTGTGGGGCTGAAAAATCTCTCAGTGCAAGTCTCAGAAGCTAACCTAATTGGTACTGG
AACAAGTGAACACTGGGTCGATGATGAAGGGCCCCAGCCAAAGAAAGTAAAGGCTGAAGA
TGAGGCCTTACTCTCAGAAGAAGATGACCCCATTGATCGACGGCCATGGACACAGCAGCA
CCTTGAAGCTGCAGACATCCGTAGGACACCATCGCTGGCTCTCACCCCTCCTCAGGCAGA
GCAGGAGGTGGATGTGTTAGATGTGAATGTCCGTGGCCCAGATGGCTGCACCCCATTGAT
GTTGGCTTCTCTCCGAGGAGGCAGCTCAGATTTGAGTGATGAAGATGAAGATGCAGAGGA
CTCTTCTGCTAACATCATCACAGACTTGGTCTACCAGGGTGCCAGCCTCCAGGCCCAGAC
AGACCGGACTGGTGAGATGGCCCTGCACCTTGCAGCCCGCTACTCACGGGCTGATGCTGC
CAAGCGTCTCCTGGATGCAGGTGCAGATGCCAATGCCCAGGACAACATGGGCCGCTGTCC
ACTCCATGCTGCAGTGGCAGCTGATGCCCAAGGTGTCTTCCAGATTCTGATTCGCAACCG
AGTAACTGATCTAGATGCCAGGATGAATGATGGTACTACACCCCTGATCCTGGCTGCCCG
CCTGGCTGTGGAGGGAATGGTGGCAGAACTGATCAACTGCCAAGCGGATGTGAATGCAGT
GGATGACCATGGAAAATCTGCTCTTCACTGGGCAGCTGCTGTCAATAATGTGGAGGCAAC
TCTTTTGTTGTTGAAAAATGGGGCCAACCGAGACATGCAGGACAACAAGGAAGAGACACC
TCTGTTTCTTGCTGCCCGGGAGGGGAGCTATGAAGCAGCCAAGATCCTGTTAGACCATTT
TGCCAATCGAGACATCACAGACCATATGGATCGTCTTCCCCGGGATGTGGCTCGGGATCG
CATGCACCATGACATTGTGCGCCTTCTGGATGAATACAATGTGACCCCAAGCCCTCCAGG
CACCGTGTTGACTTCTGCTCTCTCACCTGTCATCTGTGGGCCCAACAGATCTTTCCTCAG
CCTGAAGCACACCCCAATGGGCAAGAAGTCTAGACGGCCCAGTGCCAAGAGTACCATGCC
TACTAGCCTCCCTAACCTTGCCAAGGAGGCAAAGGATGCCAAGGGTAGTAGGAGGAAGAA
GTCTCTGAGTGAGAAGGTCCAACTGTCTGAGAGTTCAGTAACTTTATCCCCTGTTGATTC
CCTAGAATCTCCTCACACGTATGTTTCCGACACCACATCCTCTCCAATGATTACATCCCC
TGGGATCTTACAGGCCTCACCCAACCCTATGTTGGCCACTGCCGCCCCTCCTGCCCCAGT
CCATGCCCAGCATGCACTATCTTTTTCTAACCTTCATGAAATGCAGCCTTTGGCACATGG
GGCCAGCACTGTGCTTCCCTCAGTGAGCCAGTTGCTATCCCACCACCACATTGTGTCTCC
AGGCAGTGGCAGTGCTGGAAGCTTGAGTAGGCTCCATCCAGTCCCAGTCCCAGCAGATTG
GATGAACCGCATGGAGGTGAATGAGACCCAGTACAATGAGATGTTTGGTATGGTCCTGGC
TCCAGCTGAGGGCACCCATCCTGGCATAGCTCCCCAGAGCAGGCCACCTGAAGGGAAGCA
CATAACCACCCCTCGGGAGCCCTTGCCCCCCATTGTGACTTTCCAGCTCATCCCTAAAGG
CAGTATTGCCCAACCAGCGGGGGCTCCCCAGCCTCAGTCCACCTGCCCTCCAGCTGTTGC
GGGCCCCCTGCCCACCATGTACCAGATTCCAGAAATGGCCCGTTTGCCCAGTGTGGCTTT
CCCCACTGCCATGATGCCCCAGCAGGACGGGCAGGTAGCTCAGACCATTCTCCCAGCCTA
TCATCCTTTCCCAGCCTCTGTGGGCAAGTACCCCACACCCCCTTCACAGCACAGTTATGC
TTCCTCAAATGCTGCTGAGCGAACACCCAGTCACAGTGGTCACCTCCAGGGTGAGCATCC
CTACCTGACACCATCCCCAGAGTCTCCTGACCAGTGGTCAAGTTCATCACCCCACTCTGC
TTCTGACTGGTCAGATGTGACCACCAGCCCTACCCCTGGGGGTGCTGGAGGAGGTCAGCG
GGGACCTGGGACACACATGTCTGAGCCACCACACAACAACATGCAGGTTTATGCGTGAGA
GAGTCCACCTCCAGTGTAGAGACATAACTGACTTTTGTAAATGCTGCTGAGGAACAAATG
AAGGTCATCCGGGAGAGAAATGAAGAAATCTCTGGAGCCAGCTTCTAGAGGTAGGAAAGA
GAAGATGTTCTTATTCAGATAATGCAAGAGAAGCAATTCGTCAGTTTCACTGGGTATCTG
CAAGGCTTATTGATTATTCTAATCTAATAAGACAAGTTTGTGGAAATGCAAGATGAATAC
AAGCCTTGGGTCCATGTTTACTCTCTTCTATTTGGAGAATAAGATGGATGCTTATTGAAG
CCCAGACATTCTTGCAGCTTGGACTGCATTTTAAGCCCTGCAGGCTTCTGCCATATCCAT
GAGAAGATTCTACACTAGCGTCCTGTTGGGAATTATGCCCTGGAATTCTGCCTGAATTGA
CCTACGCATCTCCTCCTCCTTGGACATTCTTTTGTCTTCATTTGGTGCTTTTGGTTTTGC
ACCTCTCCGTGATTGTAGCCCTACCAGCATGTTATAGGGCAAGACCTTTGTGCTTTTGAT
CATTCTGGCCCATGAAAGCAACTTTGGTCTCCTTTCCCCTCCTGTCTTCCCGGTATCCCT
TGGAGTCTCACAAGGTTTACTTTGGTATGGTTCTCAGCACAAACCTTTCAAGTATGTTGT
TTCTTTGGAAAATGGACATACTGTATTGTGTTCTCCTGCATATATCATTCCTGGAGAGAG
AAGGGGAGAAGAATACTTTTCTTCAACAAATTTTGGGGGCAGGAGATCCCTTCAAGAGGC
TGCACCTTAATTTTTCTTGTCTGTGTGCAGGTCTTCATATAAACTTTACCAGGAAGAAGG
GTGTGAGTTTGTTGTTTTTCTGTGTATGGGCCTGGTCAGTGTAAAGTTTTATCCTTGATA
GTCTAGTTACTATGACCCTCCCCACTTTTTTAAAACCAGAAAAAGGTTTGGAATGTTGGA
ATGACCAAGAGACAAGTTAACTCGTGCAAGAGCCAGTTACCCACCCACAGGTCCCCCTAC
TTCCTGCCAAGCATTCCATTGACTGCCTGTATGGAACACATTTGTCCCAGATCTGAGCAT
TCTAGGCCTGTTTCACTCACTCACCCAGCATATGAAACTAGTCTTAACTGTTGAGCCTTT
CCTTTCATATCCACAGAAGACACTGTCTCAAATGTTGTACCCTTGCCATTTAGGACTGAA
CTTTCCTTAGCCCAAGGGACCCAGTGACAGTTGTCTTCCGTTTGTCAGATGATCAGTCTC
TACTGATTATCTTGCTGCTTAAAGGCCTGCTCACCAATCTTTCTTTCACACCGTGTGGTC
CGTGTTACTGGTATACCCAGTATGTTCTCACTGAAGACATGGACTTTATATGTTCAAGTG
CAGGAATTGGAAAGTTGGACTTGTTTTCTATGATCCAAAACAGCCCTATAAGAAGGTTGG
AAAAGGAGGAACTATATAGCAGCCTTTGCTATTTTCTGCTACCATTTCTTTTCCTCTGAA
GCGGCCATGACATTCCCTTTGGCAACTAACGTAGAAACTCAACAGAACATTTTCCTTTCC
TAGAGTCACCTTTTAGATGATAATGGACAACTATAGACTTGCTCATTGTTCAGACTGATT
GCCCCTCACCTGAATCCACTCTCTGTATTCATGCTCTTGGCAATTTCTTTGACTTTCTTT
TAAGGGCAGAAGCATTTTAGTTAATTGTAGATAAAGAATAGTTTTCTTCCTCTTCTCCTT
GGGCCAGTTAATAATTGGTCCATGGCTACACTGCAACTTCCGTCCAGTGCTGTGATGCCC
ATGACACCTGCAAAATAAGTTCTGCCTGGGCATTTTGTAGATATTAACAGGTGAATTCCC
GACTCTTTTGGTTTGAATGACAGTTCTCATTCCTTCTATGGCTGCAAGTATGCATCAGTG
CTTCCCACTTACCTGATTTGTCTGTCGGTGGCCCCATATGGAAACCCTGCGTGTCTGTTG
GCATAATAGTTTACAAATGGTTTTTTCAGTCCTATCCAAATTTATTGAACCAACAAAAAT
AATTACTTCTGCCCTGAGATAAGCAGATTAAGTTTGTTCATTCTCTGCTTTATTCTCTCC
ATGTGGCAACATTCTGTCAGCCTCTTTCATAGTGTGCAAACATTTTATCATTCTAAATGG
TGACTCTCTGCCCTTGGACCCATTTATTATTCACAGATGGGGAGAACCTATCTGCATGGA
CCTCTGTGGACCACAGCGTACCTGCCCCTTTCTGCCCTCCTGCTCCAGCCCCACTTCTGA
AAGTATCAGCTACTGATCCAGCCACTGGATATTTTATATCCTCCCTTTTCCTTAAGCACA
ATGTCAGACCAAATTGCTTGTTTCTTTTTCTTGGACTACTTTAATTTGGATCCTTTGGGT
TTGGAGAAAGGGAATGTGAAAGCTGTCATTACAGACAACAGGTTTCAGTGATGAGGAGGA
CAACACTGCCTTTCAAACTTTTTACTGATCTCTTAGATTTTAAGAACTCTTGAATTGTGT
GGTATCTAATAAAAGGGAAGGTAAGATGGATAATCACTTTCTCATTTGGGTTCTGAATTG
GAGACTCAGTTTTTATGAGACACATCTTTTATGCCATGTATAGATCCTCCCCTGCTATTT
TTGGTTTATTTTTATTGTTATAAATGCTTTCTTTCTTTGACTCCTCTTCTGCCTGCCTTT
GGGGATAGGTTTTTTTGTTTGTTTATTTGCTTCCTCTGTTTTGTTTTAAGCATCATTTTC
TTATGTGAGGTGGGGAAGGGAAAGGTATGAGGGAAAGAGAGTCTGAGAATTAAAATATTT
TAGTATAAGCAATTGGCTGTGATGCTCAAATCCATTGCATCCTCTTATTGAATTTGCCAA
TTTGTAATTTTTGCATAATAAAGAACCAAAGGTGTAATGTTTTGTTGAGAGGTGGTTTAG
GGATTTTGGCCCTAACCAATACATTGAATGTATGATGACTATTTGGGAGGACACATTTAT
GTACCCAGAGGCCCCCACTAATAAGTGGTACTATGGTTACTTCCTTGTGTACATTTCTCT
TAAAAGTGATATTATATCTGTTTGTATGAGAAACCCAGTAACCAATAAAATGACCGCATA
TTCCTGACTAAACGTAGTAAGGAAAATGCACACTTTGTTTTTACTTTTCCGTTTCATTCT
AAAGGTAGTTAAGATGAAATTTATATGAAAGCATTTTTATCACAAAATAAAAAAGGTTTG
CCAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_024408 unedited
NGCGTTAGAATTTTTTACGACTTTCTTAGGCGGCCGACGACTTCGCACGAGGGAGGCGGC
GGCCGAGGAGCGGCGGACTCGGGGCGCGGGGAGTCGAGGCATTTGCGCCTGGGCTTCGGA
GCGTAGCGCCAGGGCCTGAGCCTTTGAAGCAGGAGGAGGGGAGGAGAGAGTGGGGCTCCT
CTATCGGGACCCCCTCCCCATGTGGATCTGCCCATGCGGCGGCGGCGGCGGCGGAGGAGG
AGGCGACCGAGAAGATGCCCGCCCTGCGCCCCGCTCTGCTGTGGGCGCTGCTGGCGCTCT
GGCTGTGCTGCGCGGCCCCCGCGCATGCATTGCAGTGTCGAGATGGCTATGAACCCTGTG
TAAATGAAGGAATGTGTGTTACCTACCACAATGGCACAGGATACTGCAAATGTCCAGAAG
GCTTCTTGGGGGAATATTGTCAACATCGAGACCCCTGTGAGAAGAACCGCTGCCAGAATG
GTGGGACTTGTGTGGCCCAGGCCATGCTGGGGAAAGCCACGTGCCGATGTGCCTCAGGGT
TTACAGGAGAGGACTGCCAGTACTCAACATCTCATCCATGCTTTGTGTCTCGACCCTGCC
TGAATGGCGGCACATGCCATATGCTCAGCCGGGATACCTATGAGTGCACCTGTCAAGTCG
GGTTTACAAGTTAGGAGTGCCAATGGACGGATGCCTGCCTGTCTTATCCCTGTGCAAATG
GAAGTACCTGTACCACTGTGGGCCACCCATTTTTCTGCAAATGCTCTAAGGCTTTACAAG
GCAAAAATGGTGAAACTGATGTCAATGAGTGTGACATTCCCGGACCCTGCCAGTAGGGTG
GGCCCTGGCTTAACCTGCCTGGGTTCTACCATGGCCATGGCCCTTAGGGCTTTCAGGCCA
CTTATTGGTCAGC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_024408 unedited
GGGGACCTTCGGGGATGGTCATTCCCCAGTTCCAGGGAGAGCACTGGGGCAGGGGTCACA
GGGATGCCACCCGGGATCTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCG
AGTTTTTTTTTTTTTTTTTTTTTGGCAAACCTTTTTTATTTTGTGATAAAAATGCTTTCA
TATAAATTTCATCTTAACTACCTTTAGAATGAAACGGAAAAGTAAAAACAAAGTGTGCAT
TTTCCTTACTACGTTTAGTCAGGAATATGCGGTCATTTTATTGGTTACTGGGTTTCTCAT
ACAAACAGATATAATATCACTTTTAAGAGAAATGTACACAAGGAAGTAACCATAGTACCA
CTTATTAGTGGGGGCCTCTGGGTACATAAATGTGTCCTCCCAAATAGTCATCATACATTC
AATGTATTGGTTAGGGCCAAAATCCCTAAACCACCTCTCAACAAAACATTACACCTTTGG
TTCTTTATTATGCAAAAATTACAAATTGGCAAATTCAATAAGAGGATGCAATGGATTTGA
GCATCACAGCCAATTGCTTATACTAAAATATTTTAATTCTCAGACTCTCTTTCCCTCATA
CCTTTCCCTTCCCCACCTCACATAAAGAAAATGATGCTTAAAAACAAACAGAGGAAGCAC
ATAAACAAACAAAAAACCTTTCCCCAAAGGCCGGCCGAAGAGGAGTCAAANGAAGAAAGC
ATTTATAACATTAAAAATAACCCCAAAATTGCAGGGGAGGATCTATTACCTGCATTAAAA
GAGGTGTCTCATAAAACCTTGATTCTCCATTTCCGAACCCCAATGAGAAAGATGTTATCC
CTTCTTACCTTCCTTTTATTTAAAACCCACACATTTCAAGAGTTCTTAAATACTAAAAGA
TTAGTAAAAAGTTTGAAGAGCAGTGTTGTCCT
Tag Tag Free
ACCN NM_024408
ORF Size 7416 bp
Insert Size 11000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_024408.2, NP_077719
RefSeq Size 11433
Locus ID 4853
Cytogenetics 1p12
Domains NL, EGF_CA, ANK, EGF, EGF
Protein Families Transmembrane, Druggable Genome
Protein Pathways Dorso-ventral axis formation, Notch signaling pathway
Gene Summary This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play a role in vascular, renal and hepatic development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011].
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.