GPCR 2037 (GPR151) (NM_194251) Human Untagged Clone
CAT#: SC307577
GPR151 (untagged)-Human G protein-coupled receptor 151 (GPR151)
"NM_194251" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GPCR 2037 |
Synonyms | GALR4; GALRL; GPCR; GPCR-2037; PGR7 |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_194251 edited
ATGCTGGCAGCTGCCTTTGCAGACTCTAACTCCAGCAGCATGAATGTGTCCTTTGCTCAC CTCCACTTTGCCGGAGGGTACCTGCCCTCTGATTCCCAGGACTGGAGAACCATCATCCCG GCTCTCTTGGTGGCTGTCTGCCTGGTGGGCTTCGTGGGAAACCTGTGTGTGATTGGCATC CTCCTTCACAATGCTTGGAAAGGAAAGCCATCCATGATCCACTCCCTGATTCTGAATCTC AGCCTGGCTGATCTCTCCCTCCTGCTGTTTTCTGCACCTATCCGAGCTACGGCGTACTCC AAAAGTGTTTGGGATCTAGGCTGGTTTGTCTGCAAGTCCTCTGACTGGTTTATCCACACA TGCATGGCAGCCAAGAGCCTGACAATCGTTGTGGTGGCCAAAGTATGCTTCATGTATGCA AGTGACCCAGCCAAGCAAGTGAGTATCCACAACTACACCATCTGGTCAGTGCTGGTGGCC ATCTGGACTGTGGCTAGCCTGTTACCCCTGCCGGAATGGTTCTTTAGCACCATCAGGCAT CATGAAGGTGTGGAAATGTGCCTCGTGGATGTACCAGCTGTGGCTGAAGAGTTTATGTCG ATGTTTGGTAAGCTCTACCCACTCCTGGCATTTGGCCTTCCATTATTTTTTGCCAGCTTT TATTTCTGGAGAGCTTATGACCAATGTAAAAAACGAGGAACTAAGACTCAAAATCTTAGA AACCAGATACGCTCAAAGCAAGTCACAGTGATGCTGCTGAGCATTGCCATCATCTCTGCT CTCTTGTGGCTCCCCGAATGGGTAGCTTGGCTGTGGGTATGGCATCTGAAGGCTGCAGGC CCGGCCCCACCACAAGGTTTCATAGCCCTGTCTCAAGTCTTGATGTTTTCCATCTCTTCA GCAAATCCTCTCATTTTTCTTGTGATGTCGGAAGAGTTCAGGGAAGGCTTGAAAGGTGTA TGGAAATGGATGATAACCAAAAAACCTCCAACTGTCTCAGAGTCTCAGGAAACACCAGCT GGCAACTCAGAGGGTCTTCCTGACAAGGTTCCATCTCCAGAATCCCCAGCATCCATACCA GAAAAAGAGAAACCCAGCTCTCCCTCCTCTGGCAAAGGGAAAACTGAGAAGGCAGAGATT CCCATCCTTCCTGACGTAGAGCAGTTTTGGCATGAGAGGGACACAGTCCCTTCTGTACAG GACAATGACCCTATCCCCTGGGAACATGAAGATCAAGAGACAGGGGAAGGTGTTAAATAG |
Restriction Sites | Please inquire |
ACCN | NM_194251 |
Insert Size | 1300 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_194251.2, NP_919227.2 |
RefSeq Size | 1260 bp |
RefSeq ORF | 1260 bp |
Locus ID | 134391 |
UniProt ID | Q8TDV0 |
Cytogenetics | 5q32 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes an orphan member of the class A rhodopsin-like family of G-protein-coupled receptors (GPCRs). Within the rhodopsin-like family, this gene is a member of the SOG subfamily that includes somatostatin, opioid, galanin, and kisspeptin receptors. The orthologous mouse gene has a restricted pattern of neuronal expression which is induced following nerve injury. All GPCRs have a transmembrane domain that includes seven transmembrane alpha-helices. A general feature of GPCR signaling is the agonist-induced conformational change in the receptor, leading to activation of the heterotrimeric G protein. The activated G protein then binds to and activates numerous downstream effector proteins, which generate second messengers that mediate a broad range of cellular and physiological processes. [provided by RefSeq, Jul 2017] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220856 | GPR151 (Myc-DDK-tagged)-Human G protein-coupled receptor 151 (GPR151) |
USD 686.00 |
|
RC220856L1 | Lenti-ORF clone of GPR151 (Myc-DDK-tagged)-Human G protein-coupled receptor 151 (GPR151) |
USD 986.00 |
|
RC220856L2 | Lenti-ORF clone of GPR151 (mGFP-tagged)-Human G protein-coupled receptor 151 (GPR151) |
USD 986.00 |
|
RC220856L3 | Lenti-ORF clone of GPR151 (Myc-DDK-tagged)-Human G protein-coupled receptor 151 (GPR151) |
USD 986.00 |
|
RC220856L4 | Lenti-ORF clone of GPR151 (mGFP-tagged)-Human G protein-coupled receptor 151 (GPR151) |
USD 986.00 |
|
RG220856 | GPR151 (tGFP-tagged) - Human G protein-coupled receptor 151 (GPR151) |
USD 886.00 |
{0} Product Review(s)
Be the first one to submit a review