Rad6 (UBE2A) (NM_181762) Human Untagged Clone
CAT#: SC307361
UBE2A (untagged)-Human ubiquitin-conjugating enzyme E2A (UBE2A), transcript variant 2
"NM_181762" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UBE2A |
Synonyms | HHR6A; MRXS30; MRXSN; RAD6A; UBC2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_181762, the custom clone sequence may differ by one or more nucleotides
ATGTCCACCCCGGCTCGGCGGCGCCTCATGCGGGACTTCAAGAGGTTGCAGGAGGATCCT CCAGCCGGAGTCAGCGGGGCTCCGTCCGAGAACAACATAATGGTGTGGAACGCGGTCATT TTCGGGCCTGAAGGGACCCCGTTTGAGGATGTCTATGCAGATGGTAGTATATGTCTGGAC ATACTTCAGAACCGTTGGAGTCCAACCTATGATGTGTCTTCCATTCTAACATCCATACAG TCTCTGTTGGATGAACCCAATCCCAATAGTCCAGCAAACAGCCAGGCTGCTCAGCTGTAC CAGGAGAACAAACGGGAATATGAAAAGCGTGTTTCTGCAATAGTAGAACAAAGCTGGCGT GATTGTTGA |
Restriction Sites | Please inquire |
ACCN | NM_181762 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_181762.1, NP_861427.1 |
RefSeq Size | 1709 bp |
RefSeq ORF | 369 bp |
Locus ID | 7319 |
UniProt ID | P49459 |
Cytogenetics | Xq24 |
Protein Families | Druggable Genome |
Protein Pathways | Ubiquitin mediated proteolysis |
Gene Summary | The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair, and may play a role in transcriptional regulation. Mutations in this gene are associated with cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (2) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218483 | UBE2A (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2A (UBE2A), transcript variant 2 |
USD 165.00 |
|
RC218483L3 | Lenti-ORF clone of UBE2A (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2A (UBE2A), transcript variant 2 |
USD 465.00 |
|
RC218483L4 | Lenti-ORF clone of UBE2A (mGFP-tagged)-Human ubiquitin-conjugating enzyme E2A (UBE2A), transcript variant 2 |
USD 465.00 |
|
RG218483 | UBE2A (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2A (UBE2A), transcript variant 2 |
USD 365.00 |
{0} Product Review(s)
Be the first one to submit a review