CD200R (CD200R1) (NM_138940) Human Untagged Clone

CAT#: SC306094

CD200R1 (untagged)-Human CD200 receptor 1 (CD200R1), transcript variant 3


  "NM_138940" in other vectors (4)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-CD200R1 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CD200R1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD200R1
Synonyms CD200R; HCRTR2; MOX2R; OX2R
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_138940, the custom clone sequence may differ by one or more nucleotides
ATGCTCTGCCCTTGGAGAACTGCTAACCTAGGGCTACTGTTGATTTTGACTATCTTCTTA
GTGGCCGCTTCAAGCAGTTTATGTATGGATGAAAAACAGATTACACAGAACTACTCGAAA
GTACTCGCAGAAGTTAACACTTCATGGCCTGTAAAGATGGCTACAAATGCTGTGCTTTGT
TGCCCTCCTATCGCATTAAGAAATTTGATCATAATAACATGGGAAATAATCCTGAGAGGC
CAGCCTTCCTGCACAAAAGCCTACAAGAAAGAAACAAATGAGACCAAGGAAACCAACTGT
ACTGATGAGAGAATAACCTGGGTCTCCAGACCTGATCAGAATTCGGACCTTCAGATTCGT
ACCGTGGCCATCACTCATGACGGGTATTACAGATGCATAATGGTAACACCTGATGGGAAT
TTCCATCGTGGATATCACCTCCAAGTGTTAGGTAAGGAGCATCATATATTGAGGTATTTC
ACATCACCAGATTTGTGA
Restriction Sites Please inquire     
ACCN NM_138940
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_138940.2, NP_620386.1
RefSeq Size 956 bp
RefSeq ORF 498 bp
Locus ID 131450
UniProt ID Q8TD46
Cytogenetics 3q13.2
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a receptor for the OX-2 membrane glycoprotein. Both the receptor and substrate are cell surface glycoproteins containing two immunoglobulin-like domains. This receptor is restricted to the surfaces of myeloid lineage cells and the receptor-substrate interaction may function as a myeloid downregulatory signal. Mouse studies of a related gene suggest that this interaction may control myeloid function in a tissue-specific manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) contains multiple differences in the coding region, compared to variant 1. This results in a frameshift and early stop codon, as well as loss of an immunoglobulin and transmembrane domain in the protein (isoform c), compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.