KLF14 (NM_138693) Human Untagged Clone

CAT#: SC306059

KLF14 (untagged)-Human Kruppel-like factor 14 (KLF14)


  "NM_138693" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-KLF14 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "KLF14"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KLF14
Synonyms BTEB5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_138693 edited
GTCAAGGCCCACCATGTCGGCCGCCGTGGCGTGCCTGGACTACTTCGCCGCCGAGTGCCT
GGTGTCCATGTCCGCGGGCGCCGTGGTTCACCGCCGCCCGCCGGACCCCGAGGGCGCGGG
TGGAGCCGCAGGCTCGGAGGTGGGTGCGGCGCATCCGGAGTCCGCTCTGCCGGGTCCGGG
GCCATCGGGGCCCGCGTCGGTCCCCCAGCTCCCGCAGGTCCCCGCCCCCAGCCCCGGCGC
GGGCGGCGCCGCGCCCCACCTGCTGGCTGCAAGCGTCTGGGCGGACTTGCGCGGCAGCTC
TGGCGAGGGCTCCTGGGAGAACTCGGGGGAAGCTCCACGCGCCTCGTCCGGCTTCTCCGA
CCCGATCCCGTGCTCCGTCCAGACCCCGTGCTCCGAGCTGGCTCCCGCCTCCGGCGCCGC
GGCGGTCTGCGCTCCCGAGAGCTCCTCCGATGCGCCCGCCGTCCCAAGCGCGCCTGCTGC
CCCGGGCGCACCAGCAGCCTCTGGTGGGTTCTCTGGAGGGGCCCTAGGGGCAGGCCCCGC
CCCCGCCGCGGATCAGGCGCCCCGGAGGAGGTCTGTCACACCTGCTGCCAAGCGCCACCA
ATGCCCCTTCCCGGGCTGCACCAAAGCCTATTACAAGTCGTCGCACCTCAAGTCCCACCA
GCGCACCCACACGGGTGAGCGCCCTTTCTCCTGCGACTGGCTCGACTGCGACAAGAAGTT
TACGCGTTCCGACGAGCTGGCCCGCCACTACAGGACGCACACGGGCGAGAAGCGCTTCTC
CTGCCCCCTCTGCCCCAAGCAGTTCTCCCGGAGCGACCACCTGACCAAGCATGCTCGCCG
CCACCCAACCTATCATCCAGATATGATCGAGTACCGGGGACGTCGTCGAACTCCCCGCAT
CGACCCGCCACTCACCAGCGAGGTGGAAAGCTCCGCCTCCGGCTCCGGTCCCGGCCCGGC
GCCCAGCTTCACCACCTGCCTGTAGG
Restriction Sites Please inquire     
ACCN NM_138693
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_138693.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_138693.1, NP_619638.1
RefSeq Size 1383 bp
RefSeq ORF 972 bp
Locus ID 136259
UniProt ID Q8TD94
Cytogenetics 7q32.2
Gene Summary This intronless gene encodes a member of the Kruppel-like family of transcription factors. The encoded protein functions as a transcriptional co-repressor, and is induced by transforming growth factor-beta (TGF-beta) to repress TGF-beta receptor II gene expression. This gene exhibits imprinted expression from the maternal allele in embryonic and extra-embryonic tissues. [provided by RefSeq, Jul 2013]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.