PTCRA (NM_138296) Human Untagged Clone

CAT#: SC306002

PTCRA (untagged)-Human pre T-cell antigen receptor alpha (PTCRA)

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PTCRA (NM_138296) Human Untagged Clone
Symbol PTCRA
Synonyms PT-ALPHA; PTA
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_138296 edited
TCCTGCCTCCTTCCGAGTGGGCCATGGCCGGTACATGGCTGCTACTTCTCCTGGCCCTTG
GGTGTCCAGCCCTACCCACAGGTGTGGGCGGCACACCCTTTCCTTCTCTGGCCCCACCAA
TCATGCTGCTGGTGGATGGAAAGCAGCAGATGGTGGTGGTCTGCCTGGTCCTTGATGTTG
CACCCCCTGGCCTTGACAGCCCCATCTGGTTCTCAGCCGGCAATGGCAGTGCACTGGATG
CCTTCACCTATGGCCCTTCCCCAGCAACGGATGGCACCTGGACCAACTTGGCCCATCTCT
CCCTGCCTTCTGAGGAGCTGGCATCCTGGGAGCCTTTGGTCTGCCACACTGGGCCTGGGG
CTGAGGGTCACAGCAGGAGTACACAGCCCATGCATCTGTCAGGAGAGGCTTCTACAGCCA
GGACCTGCCCCCAGGAGCCTCTCAGGGGGACACCGGGTGGGGCGCTGTGGCTGGGGGTCC
TGCGGCTGCTGCTCTTCAAGCTGCTGCTGTTTGACCTGCTCCTGACCTGCAGCTGCCTGT
GCGACCCCGCGGGCCCGCTGCCTTCCCCCGCAACCACCACCCGCCTGCGAGCCCTCGGCT
CCCATCGACTGCACCCGGCCACGGAGACTGGGGGACGAGAGGCCACCAGCTCACCCAGAC
CCCAGCCTCGGGACCGCCGCTGGGGTGACACCCCTCCGGGTCGGAAGCCCGGGAGCCCAG
TATGGGGGGAAGGGTCTTACCTCAGCAGTTACCCCACTTGCCCAGCACAGGCCTGGTGCT
CAAGATCTGCCCTCAGGGCTCCTTCCTCCAGTCTTGGAGCATTTTTTGCAGGTGACCTGC
CTCCTCCTCTGCAGGCTGGAGCTGCCTGAGGGCAGGGCTCTACCTCCCCTGCGTCACACT
GTGTGAGGCTGTGTCTCTGCCATCCAAAAGGGGGCCCCTTGAGAATGGTGATCCACCCAG
TTACAGGGGCATTTAGGGAGCAGATGACTGAG
Tag Tag Free
ACCN NM_138296
ORF Size 846 bp
Insert Size 1000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_138296.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_138296.1, NP_612153
RefSeq Size 1080
RefSeq ORF 846
Locus ID 171558
Cytogenetics 6p21.1
Protein Families Transmembrane
Protein Pathways Notch signaling pathway
Gene Summary The protein encoded by this gene is a single-pass type I membrane protein that is found in immmature but not mature T-cells. Along with TCRB and CD3 complex, the encoded protein forms the pre-T-cell receptor complex, which regulates early T-cell development. Four transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011].
Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (2) lacks an alternate internal segment compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.