KCNK7 (NM_033348) Human Untagged Clone

CAT#: SC305619

KCNK7 (untagged)-Human potassium channel, subfamily K, member 7 (KCNK7), transcript variant B

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KCNK7
• Synonyms: K2p7.1; TWIK3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC305619 representing NM_033348.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGGGGTCTAAGGCCCTGGTCCCGATACGGGCTCCTGGTTGTGGCCCACTTGCTGGCCCTGGGGCTT
  GGGGCTGTGGTGTTCCAGGCCCTGGAGGGGCCTCCTGCATGCAGGCTTCAGGCTGAGCTCAGGGCAGAG
  CTGGCAGCCTTCCAGGCAGAGCATAGGGCCTGCCTGCCACCCGGAGCTCTGGAAGAGCTGCTGGGCACT
  GCCCTGGCCACCCAGGCCCATGGGGTCTCCACCCTGGGCAACAGCTCAGAGGGCAGGACCTGGGACCTT
  CCCTCAGCCCTGCTCTTCGCTGCCAGCATCCTCACCACCACAGGTTATGGCCACATGGCCCCACTATCG
  CCAGGCGGAAAGGCCTTCTGCATGGTCTATGCAGCCCTGGGGCTGCCAGCCTCCTTAGCTCTCGTGGCC
  ACCCTGCGCCATTGCCTGCTGCCTGTGCTCAGCCGCCCACGTGCCTGGGTAGCGGTCCACTGGCAGCTG
  TCACCGGCCAGGGCTGCGCTGCTGCAGGCAGTTGCACTGGGACTGCTGGTGGCCAGCAGCTTTGTGCTG
  CTGCCAGCGCTGGTGCTGTGGGGCCTTCAGGGCGACTGCAGCCTGCTGGGGGCCGTCTACTTCTGCTTC
  AGCTCGCTCAGCACCATTGGCCTGGAGGACTTGCTGCCCGGCCGCGGCCGCAGCCTGCACCCCGTGATT
  TACCACCTGGGCCAGCTCGCACTTCTTGGTGGAGGGACCTCACTCCAGGGCACGGCGTGGGAGGGGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_033348
• Insert Size: 759 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_033348.1
• RefSeq Size: 1388 bp
• RefSeq ORF: 759 bp
• Locus ID: 10089
• UniProt ID: Q9Y2U2
• Cytogenetics: 11q13.1
• Protein Families: Druggable Genome, Ion Channels: Potassium, Transmembrane
• MW: 26.2 kDa
• Gene Summary: This gene encodes a member of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel; however, it may require other non-pore-forming proteins for activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (B) has an additional exon in the 3' region, compared to variant A. The resulting isoform (B) is shorter and has a distinct C-terminus, compared to isoform A.