KIR2DS2 (NM_012312) Human Untagged Clone

CAT#: SC303956

KIR2DS2 (untagged)-Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2 (KIR2DS2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KIR2DS2
• Synonyms: 183ActI; CD158b; CD158J; cl-49; KIR-2DS2; KIR2DL1; NKAT-5; NKAT5
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_012312 edited
  ATGTCGCTCATGGTCGTCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGG
  CCACATGAGGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAA
  TCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCAGGTTTGAGCACTTCCTTCTG
  CACAGAGAGGGGAAGTATAAGGACACTTTGCACCTCATTGGAGAGCACCATGATGGGGTC
  TCCAAGGCCAACTTCTCCATCGGTCCCATGATGCAAGACCTTGCAGGGACCTACAGATGC
  TACGGTTCTGTTACTCACTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATC
  GTCATCACAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTTTG
  GCAGGAGAGAGCGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATGTACCATCTA
  TCCAGGGAGGGGGAGGCCCATGAACGTAGGTTCTCTGCAGGGCCCAAGGTCAACGGAACA
  TTCCAGGCCGACTTTCCTCTGGGCCCTGCCACCCACGGAGGAACCTACAGATGCTTCGGC
  TCTTTCCGTGACTCTCCCTATGAGTGGTCAAACTCGAGTGACCCACTGCTTGTTTCTGTC
  ACAGGAAACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTAAC
  CCCAGACACCTGCATGTTCTGATTGGGACCTCAGTGGTCAAAATCCCTTTCACCATCCTC
  CTCTTCTTTCTCCTTCATCGCTGGTGCTCCAACAAAAAAAATGCTGCTGTAATGGACCAA
  GAGCCTGCAGGGAACAGAACAGTGAACAGCGAGGATTCTGATGAACAAGACCATCAGGAG
  GTGTCATACGCATAATTGGATCACTGTGTTTTCACACAGAGAGAAATCACTCGCCCTTCT
  GAGAGGCCCAA
  
• Restriction Sites: Please inquire
• ACCN: NM_012312
• Insert Size: 1000 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_012312.1.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_012312.1, NP_036444.1
• RefSeq Size: 1557 bp
• RefSeq ORF: 915 bp
• Locus ID: 100132285
• UniProt ID: P43631
• Cytogenetics: 19q13.4
• Gene Summary: Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. This gene represents a haplotype-specific family member that encodes a protein with a short cytoplasmic tail. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
  Transcript Variant: This variant (1) represents the longest transcript and encodes isoform a.