POLD3 (NM_006591) Human Untagged Clone

CAT#: SC303795

POLD3 (untagged)-Human polymerase (DNA-directed), delta 3, accessory subunit (POLD3)


  "NM_006591" in other vectors (4)

Reconstitution Protocol

USD 732.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
POLD3 Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "POLD3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol POLD3
Synonyms P66; P68; PPP1R128
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303795 representing NM_006591.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGACCAGCTTTATCTGGAAAATATAGACGAGTTCGTCACGGACCAAAACAAGATCGTGACATAC
AAATGGCTGAGCTATACACTAGGGGTTCATGTTAACCAGGCCAAACAGATGCTGTATGATTATGTTGAA
AGGAAACGAAAAGAAAATTCAGGAGCCCAACTGCATGTTACCTACTTGGTGTCTGGCAGTCTCATTCAG
AATGGACATTCCTGCCACAAGGTTGCAGTAGTGAGAGAAGATAAATTGGAAGCAGTGAAGTCCAAGCTA
GCTGTGACTGCCAGCATCCATGTGTACAGCATCCAGAAAGCCATGCTAAAGGACAGTGGGCCTCTGTTC
AATACTGACTATGACATCCTTAAAAGCAACTTGCAGAACTGCAGCAAATTTAGTGCTATACAATGTGCA
GCTGCCGTCCCTAGAGCTCCTGCTGAATCCTCTTCGTCTTCCAAAAAGTTTGAGCAGTCACATCTTCAC
ATGTCAAGTGAGACACAAGCCAACAATGAGCTGACCACCAATGGTCATGGCCCACCTGCATCCAAGCAG
GTTTCCCAGCAGCCCAAAGGAATTATGGGAATGTTTGCCTCCAAAGCTGCTGCTAAAACCCAAGAAACC
AACAAGGAAACGAAAACAGAGGCTAAAGAAGTAACAAATGCATCTGCAGCAGGCAACAAGGCACCAGGG
AAAGGGAATATGATGAGCAACTTTTTTGGAAAAGCTGCTATGAATAAATTTAAAGTCAATTTGGACTCA
GAACAAGCAGTGAAAGAAGAAAAAATAGTGGAGCAGCCTACAGTGTCTGTCACGGAACCAAAGCTGGCA
ACTCCTGCAGGCCTGAAAAAATCCAGCAAAAAAGCAGAGCCTGTTAAGGTGCTGCAGAAGGAAAAAAAA
AGGGGGAAGCGAGTAGCATTATCTGATGATGAGACAAAGGAAACTGAAAACATGAGGAAAAAGAGGAGA
AGAATCAAACTTCCTGAATCTGATAGCAGTGAAGATGAAGTCTTTCCAGACTCTCCTGGGGCTTATGAA
GCTGAGTCACCATCCCCACCTCCTCCTCCGTCTCCACCTCTTGAACCAGTGCCAAAGACTGAGCCTGAA
CCTCCTTCTGTCAAGAGCTCAAGTGGAGAAAACAAAAGAAAACGAAAACGCGTACTAAAATCTAAAACT
TACCTGGATGGGGAAGGCTGCATAGTGACTGAAAAAGTCTACGAGAGTGAATCCTGCACAGATAGTGAA
GAGGAGCTTAACATGAAGACATCCTCAGTACACAGACCCCCTGCCATGACTGTGAAAAAAGAACCCAGA
GAGGAACGAAAGGGCCCCAAGAAAGGGACTGCTGCTCTGGGCAAAGCCAACAGACAGGTGTCCATTACT
GGCTTCTTCCAGAGGAAATAA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_006591
Insert Size 1401 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006591.2
RefSeq Size 3824 bp
RefSeq ORF 1401 bp
Locus ID 10714
UniProt ID Q15054
Cytogenetics 11q13.4
Protein Pathways Base excision repair, DNA replication, Homologous recombination, Metabolic pathways, Mismatch repair, Nucleotide excision repair, Purine metabolism, Pyrimidine metabolism
MW 51.4 kDa
Gene Summary This gene encodes the 66-kDa subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein plays a role in regulating the activity of DNA polymerase delta through interactions with other subunits and the processivity cofactor proliferating cell nuclear antigen (PCNA). Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (1) is protein-coding.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.