EDA (NM_001399) Human Untagged Clone
CAT#: SC303010
EDA (untagged)-Human ectodysplasin A (EDA), transcript variant 1
"NM_001399" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EDA |
Synonyms | ECTD1; ED1; ED1-A1; ED1-A2; EDA-A1; EDA-A2; EDA1; EDA2; HED; HED1; ODT1; STHAGX1; TNLG7C; XHED; XLHED |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001399, the custom clone sequence may differ by one or more nucleotides
ATGGGCTACCCGGAGGTGGAGCGCAGGGAACTCCTGCCTGCAGCAGCGCCGCGGGAGCGA GGGAGCCAGGGCTGCGGGTGTGGCGGGGCCCCTGCCCGGGCGGGCGAAGGGAACAGCTGC CTGCTCTTCCTGGGTTTCTTTGGCCTCTCGCTGGCCCTCCACCTGCTGACGTTGTGCTGC TACCTAGAGTTGCGCTCGGAGTTGCGGCGGGAACGTGGAGCCGAGTCCCGCCTTGGCGGC TCGGGCACCCCTGGCACCTCTGGCACCCTAAGCAGCCTCGGTGGCCTCGACCCTGACAGC CCCATCACCAGTCACCTTGGGCAGCCGTCACCTAAGCAGCAGCCATTGGAACCGGGAGAA GCCGCACTCCACTCTGACTCCCAGGACGGGCACCAGATGGCCCTATTGAATTTCTTCTTC CCTGATGAAAAGCCATACTCTGAAGAAGAAAGTAGGCGTGTTCGCCGCAATAAAAGAAGC AAAAGCAATGAAGGAGCAGATGGCCCAGTTAAAAACAAGAAAAAGGGAAAGAAAGCAGGA CCTCCTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCCAGGACCCCAGGGACCCCCA GGAATTCCAGGGATTCCTGGAATTCCAGGAACAACTGTTATGGGACCACCTGGTCCTCCA GGTCCTCCTGGTCCTCAAGGACCCCCTGGCCTCCAGGGACCTTCTGGTGCTGCTGATAAA GCTGGAACTCGAGAAAACCAGCCAGCTGTGGTGCATCTACAGGGCCAAGGGTCAGCAATT CAAGTCAAGAATGATCTTTCAGGTGGAGTGCTCAATGACTGGTCTCGCATCACTATGAAC CCCAAGGTGTTTAAGCTACATCCCCGCAGCGGGGAGCTGGAGGTACTGGTGGACGGCACC TACTTCATCTATAGTCAGGTAGAAGTATACTACATCAACTTCACTGACTTTGCCAGCTAT GAGGTGGTGGTGGATGAGAAGCCCTTCCTGCAGTGCACACGCAGCATCGAGACGGGCAAG ACCAACTACAACACTTGCTATACCGCAGGCGTCTGCCTCCTCAAGGCCCGGCAGAAGATC GCCGTCAAGATGGTGCACGCTGACATCTCCATCAACATGAGCAAGCACACCACGTTCTTT GGGGCCATCAGGCTGGGTGAAGCCCCTGCATCCTAG |
Restriction Sites | Please inquire |
ACCN | NM_001399 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001399.4, NP_001390.1 |
RefSeq Size | 5296 bp |
RefSeq ORF | 1176 bp |
Locus ID | 1896 |
UniProt ID | Q92838 |
Cytogenetics | Xq13.1 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction |
Gene Summary | The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1, also known as EDA-A1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219939 | EDA (Myc-DDK-tagged)-Human ectodysplasin A (EDA), transcript variant 1 |
USD 732.00 |
|
RC219939L3 | Lenti-ORF clone of EDA (Myc-DDK-tagged)-Human ectodysplasin A (EDA), transcript variant 1 |
USD 1,032.00 |
|
RC219939L4 | Lenti-ORF clone of EDA (mGFP-tagged)-Human ectodysplasin A (EDA), transcript variant 1 |
USD 1,032.00 |
|
RG219939 | EDA (tGFP-tagged) - Human ectodysplasin A (EDA), transcript variant 1 |
USD 932.00 |
{0} Product Review(s)
Be the first one to submit a review