UBA52 (NM_001033930) Human Untagged Clone
CAT#: SC302780
UBA52 (untagged)-Human ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), transcript variant 1
"NM_001033930" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UBA52 |
Synonyms | CEP52; HUBCEP52; L40; RPL40 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302780 representing NM_001033930.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGATCTTTGTGAAGACCCTCACTGGCAAAACCATCACCCTTGAGGTCGAGCCCAGTGACACCATT GAGAATGTCAAAGCCAAAATTCAAGACAAGGAGGGTATCCCACCTGACCAGCAGCGTCTGATATTTGCC GGCAAACAGCTGGAGGATGGCCGCACTCTCTCAGACTACAACATCCAGAAAGAGTCCACCCTGCACCTG GTGTTGCGCCTGCGAGGTGGCATTATTGAGCCTTCTCTCCGCCAGCTTGCCCAGAAATACAACTGCGAC AAGATGATCTGCCGCAAGTGCTATGCTCGCCTTCACCCTCGTGCTGTCAACTGCCGCAAGAAGAAGTGT GGTCACACCAACAACCTGCGTCCCAAGAAGAAGGTCAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001033930 |
Insert Size | 387 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001033930.2 |
RefSeq Size | 2825 bp |
RefSeq ORF | 387 bp |
Locus ID | 7311 |
UniProt ID | P62987 |
Cytogenetics | 19p13.11 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Ribosome |
MW | 14.7 kDa |
Gene Summary | Ubiquitin is a highly conserved nuclear and cytoplasmic protein that has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N terminus and ribosomal protein L40 at the C terminus, a C-terminal extension protein (CEP). Multiple processed pseudogenes derived from this gene are present in the genome. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214495 | UBA52 (Myc-DDK-tagged)-Human ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), transcript variant 1 |
USD 150.00 |
|
RC214495L3 | Lenti ORF clone of Human ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), transcript variant 1, Myc-DDK-tagged |
USD 450.00 |
|
RC214495L4 | Lenti ORF clone of Human ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), transcript variant 1, mGFP tagged |
USD 450.00 |
|
RG214495 | UBA52 (tGFP-tagged) - Human ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), transcript variant 1 |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review