RPS14 (NM_001025071) Human Untagged Clone

CAT#: SC302334

RPS14 (untagged)-Human ribosomal protein S14 (RPS14), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RPS14
• Synonyms: EMTB; S14
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC302334 representing NM_001025071.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCACCTCGAAAGGGGAAGGAAAAGAAGGAAGAACAGGTCATCAGCCTCGGACCTCAGGTGGCTGAA
  GGAGAGAATGTATTTGGTGTCTGCCATATCTTTGCATCCTTCAATGACACTTTTGTCCATGTCACTGAT
  CTTTCTGGCAAGGAAACCATCTGCCGTGTGACTGGTGGGATGAAGGTAAAGGCAGACCGAGATGAATCC
  TCACCATATGCTGCTATGTTGGCTGCCCAGGATGTGGCCCAGAGGTGCAAGGAGCTGGGTATCACCGCC
  CTACACATCAAACTCCGGGCCACAGGAGGAAATAGGACCAAGACCCCTGGACCTGGGGCCCAGTCGGCC
  CTCAGAGCCCTTGCCCGCTCGGGTATGAAGATCGGGCGGATTGAGGATGTCACCCCCATCCCCTCTGAC
  AGCACTCGCAGGAAGGGGGGTCGCCGTGGTCGCCGTCTGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001025071
• Insert Size: 456 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001025071.1
• RefSeq Size: 793 bp
• RefSeq ORF: 456 bp
• Locus ID: 6208
• UniProt ID: P62263
• Cytogenetics: 5q33.1
• MW: 16.3 kDa
• Gene Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S11P family of ribosomal proteins. It is located in the cytoplasm. Transcript variants utilizing alternative transcription initiation sites have been described in the literature. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. In Chinese hamster ovary cells, mutations in this gene can lead to resistance to emetine, a protein synthesis inhibitor. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) represents the longest transcript.