C 4 Methylsterol Oxidase (MSMO1) (NM_001017369) Human Untagged Clone

CAT#: SC302022

MSMO1 (untagged)-Human sterol-C4-methyl oxidase-like (SC4MOL), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: C 4 Methylsterol Oxidase
• Synonyms: DESP4; ERG25; MCCPD; SC4MOL
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001017369 edited
  ATGCCAAGATGGTATTTTCTTTTGGCAAGATGCTTTGGTTGTGCAGTCATTGAAGATACT
  TGGCACTATTTTCTGCATAGACTCTTACACCACAAAAGAATATACAAGTATATTCATAAA
  GTTCATCATGAGTTTCAGGCTCCATTTGGAATGGAAGCTGAATATGCACATCCTTTGGAG
  ACTCTAATTCTTGGAACTGGATTTTTCATTGGAATCGTGCTTTTGTGTGATCATGTAATT
  CTTCTTTGGGCATGGGTGACCATTCGTTTATTAGAAACTATTGATGTCCATAGTGGTTAT
  GATATTCCTCTCAACCCTTTAAATCTGATCCCTTTCTATGCTGGTTCTCGGCATCATGAT
  TTCCACCACATGAACTTCATTGGAAACTATGCTTCAACATTTACATGGTGGGATCGAATT
  TTTGGAACAGACTCTCAGTATAATGCCTATAATGAAAAGAGGAAGAAGTTTGAGAAAAAG
  ACTGAATAA
  
• Restriction Sites: NotI-NotI
• ACCN: NM_001017369
• Insert Size: 2000 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001017369.1, NP_001017369.1
• RefSeq Size: 1928 bp
• RefSeq ORF: 489 bp
• Locus ID: 6307
• UniProt ID: Q15800
• Cytogenetics: 4q32.3
• Protein Families: Transmembrane
• Protein Pathways: Metabolic pathways, Steroid biosynthesis
• Gene Summary: Sterol-C4-mehtyl oxidase-like protein was isolated based on its similarity to the yeast ERG25 protein. It contains a set of putative metal binding motifs with similarity to that seen in a family of membrane desaturases-hydroxylases. The protein is localized to the endoplasmic reticulum membrane and is believed to function in cholesterol biosynthesis. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks an exon in the 5' region, resulting in translation initiation from a downstream AUG codon, as compared to variant 1. The encoded isoform 2 has a shorter N-terminus, as compared to isoform 1.