RNS10 (RNASE10) (NM_001012975) Human Untagged Clone

CAT#: SC301743

RNASE10 (untagged)-Human ribonuclease, RNase A family, 10 (non-active) (RNASE10)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RNS10
• Synonyms: RAH1; RNASE9
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC301743 representing NM_001012975.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAAGCTGAATCTGGTGCAGATCTTTTTCATGTTGCTGATGCTGCTGCTGGGCCTGGGGATGGGCCTG
  GGGTTGGGACTTCATATGGCTACAGCAGTCTTGGAGGAGAGTGATCAACCGCTCAATGAATTTTGGTCC
  AGTGACTCACAGGACAAAGCTGAGGCCACTGAGGAGGGAGACGGCACCCAAACCACAGAAACGCTGGTG
  CTTAGCAACAAAGAAGTGGTGCAACCTGGCTGGCCAGAAGATCCCATCCTCGGTGAAGATGAGGTTGGG
  GGTAACAAGATGCTCAGAGCCTCAGCTCTCTTTCAGAGCAACAAAGACTATCTTAGGCTTGACCAGACA
  GATAGAGAATGCAATGATATGATGGCACACAAGATGAAGGAGCCCAGTCAGAGTTGCATAGCCCAGTAT
  GCATTCATCCATGAGGATCTAAACACAGTCAAAGCTGTCTGTAACAGTCCTGTCATTGCCTGTGAGCTC
  AAGGGGGGAAAATGTCACAAAAGCTCCCGACCTTTTGATTTGACATTGTGCGAGCTGTCCCAACCAGAC
  CAGGTCACTCCTAACTGCAATTACCTAACTTCTGTTATAAAAAAGCACATTATTATAACCTGTAATGAC
  ATGAAGCGCCAGTTACCAACTGGACAATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001012975
• Insert Size: 651 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001012975.1
• RefSeq Size: 651 bp
• RefSeq ORF: 651 bp
• Locus ID: 338879
• UniProt ID: Q5GAN6
• Cytogenetics: 14q11.2
• Protein Families: Secreted Protein, Transmembrane
• MW: 24 kDa
• Gene Summary: Secreted proximal epididymal protein required for post-testicular sperm maturation and male fertility. May be involved in sperm adhesion to the egg zona pellucida. Does not have ribonuclease activity (By similarity).[UniProtKB/Swiss-Prot Function]