SLC25A30 (NM_001010875) Human Untagged Clone

CAT#: SC301498

SLC25A30 (untagged)-Human solute carrier family 25, member 30 (SLC25A30), nuclear gene encoding mitochondrial protein


  "NM_001010875" in other vectors (6)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
SLC25A30 Antibody - N-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SLC25A30"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC25A30
Synonyms KMCP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301498 representing NM_001010875.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCAGCCCTCAACTGGAAGCCGTTTGTGTACGGGGGGCTGGCCTCCATCACTGCTGAGTGCGGTACA
TTTCCAATTGATTTAACCAAGACACGGCTCCAGATTCAAGGCCAGACGAATGATGCAAAATTTAAGGAA
ATTAGATACCGAGGAATGTTGCACGCATTAGTGAGGATAGGCAGAGAAGAAGGGCTGAAAGCACTCTAC
TCGGGGATTGCCCCCGCGATGTTACGCCAGGCATCCTATGGCACCATCAAGATAGGCACTTACCAGAGC
TTGAAGCGACTATTCATTGAACGCCCAGAAGATGAAACTCTACCGATAAATGTGATATGTGGAATTCTG
TCTGGAGTCATATCTTCAACCATTGCTAATCCAACTGATGTTTTGAAAATTCGGATGCAAGCGCAAAGC
AACACCATTCAAGGAGGAATGATAGGCAACTTCATGAACATTTACCAGCAAGAGGGGACAAGAGGACTG
TGGAAGGGTGTGTCCCTTACTGCGCAGAGGGCTGCTATTGTTGTTGGTGTGGAGCTGCCGGTCTATGAC
ATCACCAAGAAGCATCTTATTCTCTCAGGCCTGATGGGAGACACTGTGTATACCCACTTCCTCTCAAGC
TTCACCTGTGGTCTGGCAGGGGCCCTGGCCTCAAACCCTGTTGATGTTGTGAGGACACGTATGATGAAT
CAGAGAGTGCTTCGAGATGGCAGATGTTCTGGCTACACAGGAACCCTGGATTGCTTGTTACAGACATGG
AAGAATGAAGGGTTTTTTGCTCTCTATAAAGGCTTTTGGCCAAATTGGTTGAGACTTGGTCCTTGGAAT
ATCATTTTCTTTGTGACATACGAGCAGTTGAAGAAATTGGATTTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001010875
Insert Size 876 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001010875.3
RefSeq Size 3745 bp
RefSeq ORF 876 bp
Locus ID 253512
UniProt ID Q5SVS4
Cytogenetics 13q14.13
MW 32.5 kDa
Gene Summary Although the outer mitochondrial membrane is permeable to many small metabolites, transport of solutes across the inner mitochondrial membrane is achieved by members of the mitochondrial carrier protein family, such as SLC25A30 (Haguenauer et al., 2005 [PubMed 15809292]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.