SLC25A30 (NM_001010875) Human Untagged Clone
CAT#: SC301498
SLC25A30 (untagged)-Human solute carrier family 25, member 30 (SLC25A30), nuclear gene encoding mitochondrial protein
"NM_001010875" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SLC25A30 |
Synonyms | KMCP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301498 representing NM_001010875.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCAGCCCTCAACTGGAAGCCGTTTGTGTACGGGGGGCTGGCCTCCATCACTGCTGAGTGCGGTACA TTTCCAATTGATTTAACCAAGACACGGCTCCAGATTCAAGGCCAGACGAATGATGCAAAATTTAAGGAA ATTAGATACCGAGGAATGTTGCACGCATTAGTGAGGATAGGCAGAGAAGAAGGGCTGAAAGCACTCTAC TCGGGGATTGCCCCCGCGATGTTACGCCAGGCATCCTATGGCACCATCAAGATAGGCACTTACCAGAGC TTGAAGCGACTATTCATTGAACGCCCAGAAGATGAAACTCTACCGATAAATGTGATATGTGGAATTCTG TCTGGAGTCATATCTTCAACCATTGCTAATCCAACTGATGTTTTGAAAATTCGGATGCAAGCGCAAAGC AACACCATTCAAGGAGGAATGATAGGCAACTTCATGAACATTTACCAGCAAGAGGGGACAAGAGGACTG TGGAAGGGTGTGTCCCTTACTGCGCAGAGGGCTGCTATTGTTGTTGGTGTGGAGCTGCCGGTCTATGAC ATCACCAAGAAGCATCTTATTCTCTCAGGCCTGATGGGAGACACTGTGTATACCCACTTCCTCTCAAGC TTCACCTGTGGTCTGGCAGGGGCCCTGGCCTCAAACCCTGTTGATGTTGTGAGGACACGTATGATGAAT CAGAGAGTGCTTCGAGATGGCAGATGTTCTGGCTACACAGGAACCCTGGATTGCTTGTTACAGACATGG AAGAATGAAGGGTTTTTTGCTCTCTATAAAGGCTTTTGGCCAAATTGGTTGAGACTTGGTCCTTGGAAT ATCATTTTCTTTGTGACATACGAGCAGTTGAAGAAATTGGATTTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001010875 |
Insert Size | 876 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001010875.3 |
RefSeq Size | 3745 bp |
RefSeq ORF | 876 bp |
Locus ID | 253512 |
UniProt ID | Q5SVS4 |
Cytogenetics | 13q14.13 |
MW | 32.5 kDa |
Gene Summary | Although the outer mitochondrial membrane is permeable to many small metabolites, transport of solutes across the inner mitochondrial membrane is achieved by members of the mitochondrial carrier protein family, such as SLC25A30 (Haguenauer et al., 2005 [PubMed 15809292]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212728 | SLC25A30 (Myc-DDK-tagged)-Human solute carrier family 25, member 30 (SLC25A30), nuclear gene encoding mitochondrial protein |
USD 450.00 |
|
RC212728L1 | Lenti ORF clone of Human solute carrier family 25, member 30 (SLC25A30), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 750.00 |
|
RC212728L2 | Lenti ORF clone of Human solute carrier family 25, member 30 (SLC25A30), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 750.00 |
|
RC212728L3 | Lenti ORF clone of Human solute carrier family 25, member 30 (SLC25A30), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 750.00 |
|
RC212728L4 | Lenti ORF clone of Human solute carrier family 25, member 30 (SLC25A30), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 750.00 |
|
RG212728 | SLC25A30 (tGFP-tagged) - Human solute carrier family 25, member 30 (SLC25A30), nuclear gene encoding mitochondrial protein |
USD 650.00 |
{0} Product Review(s)
Be the first one to submit a review