B4GALT3 (B4GALT2) (NM_001005417) Human Untagged Clone

CAT#: SC300951

B4GALT2 (untagged)-Human UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 (B4GALT2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: B4GALT3
• Synonyms: B4Gal-T2; B4Gal-T3; beta4Gal-T2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC300951 representing NM_001005417.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGCAGACTGCTGGGGGGGACGCTGGAGCGCGTCTGCAAGGCTGTGCTCCTTCTCTGCCTGCTGCAC
  TTCCTCGTGGCCGTCATCCTCTACTTTGACGTCTACGCCCAGCACCTGGCCTTCTTCAGCCGCTTCAGT
  GCCCGAGGCCCTGCCCATGCCCTCCACCCAGCTGCTAGCAGCAGCAGCAGCAGCAGCAACTGCTCCCGG
  CCCAACGCCACCGCCTCTAGCTCCGGGCTCCCTGAGGTCCCCAGTGCCCTGCCCGGTCCCACGGCTCCC
  ACGCTGCCACCCTGTCCTGACTCGCCACCTGGTCTTGTGGGCAGACTGCTGATCGAGTTCACCTCACCC
  ATGCCCCTGGAGCGGGTGCAGAGGGAGAACCCAGGCGTGCTCATGGGCGGCCGATACACACCGCCCGAC
  TGCACCCCAGCCCAGACGGTGGCGGTCATCATCCCCTTTAGACACCGGGAACACCACCTGCGCTACTGG
  CTCCACTATCTACACCCCATCTTGAGGCGGCAGCGGCTGCGCTACGGCGTCTATGTCATCAACCAGCAT
  GGTGAGGACACCTTCAACCGGGCCAAGCTGCTTAACGTGGGCTTCCTAGAGGCGCTGAAGGAGGATGCC
  GCCTATGACTGCTTCATCTTCAGCGATGTGGACCTGGTCCCCATGGATGACCGCAACCTATACCGCTGC
  GGCGACCAACCCCGCCACTTTGCCATTGCCATGGACAAGTTTGGCTTCCGGCTTCCCTATGCTGGCTAC
  TTTGGAGGTGTGTCAGGCCTGAGTAAGGCTCAGTTTCTGAGAATCAATGGCTTCCCCAATGAGTACTGG
  GGCTGGGGTGGCGAGGATGATGACATCTTCAACCGGATCTCCCTGACTGGGATGAAGATCTCACGCCCA
  GACATCCGAATCGGCCGCTACCGCATGATCAAGCACGACCGCGACAAGCATAACGAACCTAACCCTCAG
  AGGTTTACCAAGATTCAAAACACGAAGCTGACCATGAAGCGGGACGGCATTGGGTCAGTGCGGTACCAG
  GTCTTGGAGGTGTCTCGGCAACCACTCTTCACCAATATCACAGTGGACATTGGGCGGCCTCCGTCGTGG
  CCCCCTCGGGGCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001005417
• Insert Size: 1119 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001005417.2
• RefSeq Size: 2009 bp
• RefSeq ORF: 1119 bp
• Locus ID: 8704
• UniProt ID: O60909
• Cytogenetics: 1p34.1
• Protein Families: Transmembrane
• Protein Pathways: Galactose metabolism, Glycosphingolipid biosynthesis - lacto and neolacto series, Keratan sulfate biosynthesis, Metabolic pathways, N-Glycan biosynthesis
• MW: 42 kDa
• Gene Summary: This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene synthesizes N-acetyllactosamine in glycolipids and glycoproteins. Its substrate specificity is affected by alpha-lactalbumin but it is not expressed in lactating mammary tissue. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2 and 3 both encode isoform b.