FIGLA (NM_001004311) Human Untagged Clone
CAT#: SC300630
FIGLA (untagged)-Human folliculogenesis specific basic helix-loop-helix (FIGLA)
"NM_001004311" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FIGLA |
Synonyms | BHLHC8; FIGALPHA; POF6 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001004311 edited
ATGGACCCCGCGCCCGGCGTCCTAGATCCCCGCGCCGCGCCGCCCGCGCTCCTGGGCACC CCGCAAGCCGAGGTGCTGGAGGACGTGTTGCGGGAGCAGTTCGGGCCGCTGCCCCAGCTG GCCGCTGTCTGCCGGCTCAAGCGGCTGCCCTCGGGCGGCTACTCGTCCACTGAAAACCTC CAGTTGGTGCTGGAGCGGCGGCGTGTGGCCAACGCCAAGGAGCGTGAGCGGATAAAAAAT CTCAACCGTGGTTTTGCCAGATTGAAGGCACTTGTGCCATTTCTTCCCCAAAGCAGGAAG CCCAGCAAAGTTGATATCCTTAAAGGTGCGACTGAATATATACAGGTTCTCAGTGATCTT TTGGAAGGAGCCAAAGACTCAAAGAAACAAGACCCAGATGAGCAGAGCTATAGTAACAAC AGTTCTGAATCACATACATCCTCGGCAAGACAGCTGTCAAGAAACATCACCCAACATATC AGCTGTGCTTTCGGCTTGAAGAATGAAGAGGAAGGGCCTTGGGCAGATGGTGGCAGTGGT GAGCCAGCACACGCTTGTCGCCACAGTGTGATGTCTACGACTGAAATTATCTCCCCAACC AGAAGTCTGGATAGATTCCCAGAAGTAGAACTGCTGAGTCACAGACTTCCACAAGTATGA |
Restriction Sites | Please inquire |
ACCN | NM_001004311 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001004311.1, NP_001004311.1 |
RefSeq Size | 724 bp |
RefSeq ORF | 660 bp |
Locus ID | 344018 |
UniProt ID | Q6QHK4 |
Cytogenetics | 2p13.3 |
Gene Summary | This gene encodes a protein that functions in postnatal oocyte-specific gene expression. The protein is a basic helix-loop-helix transcription factor that regulates multiple oocyte-specific genes, including genes involved in folliculogenesis and those that encode the zona pellucida. Mutations in this gene cause premature ovarian failure type 6. [provided by RefSeq, Sep 2009] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212562 | FIGLA (Myc-DDK-tagged)-Human folliculogenesis specific basic helix-loop-helix (FIGLA) |
USD 300.00 |
|
RC212562L3 | Lenti ORF clone of Human folliculogenesis specific basic helix-loop-helix (FIGLA), Myc-DDK-tagged |
USD 600.00 |
|
RC212562L4 | Lenti ORF clone of Human folliculogenesis specific basic helix-loop-helix (FIGLA), mGFP tagged |
USD 600.00 |
|
RG212562 | FIGLA (tGFP-tagged) - Human folliculogenesis specific basic helix-loop-helix (FIGLA) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review