ADH7 (NM_000673) Human Untagged Clone

CAT#: SC300120

ADH7 (untagged)-Human alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide (ADH7), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ADH7
• Synonyms: ADH4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC300120 representing NM_000673.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTTTGCAGAAATACAGATCCAAGACAAAGACAGGATGGGCACTGCTGGAAAAGTTATTAAATGCAAA
  GCAGCTGTGCTTTGGGAGCAGAAGCAACCCTTCTCCATTGAGGAAATAGAAGTTGCCCCACCAAAGACT
  AAAGAAGTTCGCATTAAGATTTTGGCCACAGGAATCTGTCGCACAGATGACCATGTGATAAAAGGAACA
  ATGGTGTCCAAGTTTCCAGTGATTGTGGGACATGAGGCAACTGGGATTGTAGAGAGCATTGGAGAAGGA
  GTGACTACAGTGAAACCAGGTGACAAAGTCATCCCTCTCTTTCTGCCACAATGTAGAGAATGCAATGCT
  TGTCGCAACCCAGATGGCAACCTTTGCATTAGGAGCGATATTACTGGTCGTGGAGTACTGGCTGATGGC
  ACCACCAGATTTACATGCAAGGGCAAACCAGTCCACCACTTCATGAACACCAGTACATTTACCGAGTAC
  ACAGTGGTGGATGAATCTTCTGTTGCTAAGATTGATGATGCAGCTCCTCCTGAGAAAGTCTGTTTAATT
  GGCTGTGGGTTTTCCACTGGATATGGCGCTGCTGTTAAAACTGGCAAGGTCAAACCTGGTTCCACTTGC
  GTCGTCTTTGGCCTGGGAGGAGTTGGCCTGTCAGTCATCATGGGCTGTAAGTCAGCTGGTGCATCTAGG
  ATCATTGGGATTGACCTCAACAAAGACAAATTTGAGAAGGCCATGGCTGTAGGTGCCACTGAGTGTATC
  AGTCCCAAGGACTCTACCAAACCCATCAGTGAGGTGCTGTCAGAAATGACAGGCAACAACGTGGGATAC
  ACCTTTGAAGTTATTGGGCATCTTGAAACCATGATTGATGCCCTGGCATCCTGCCACATGAACTATGGG
  ACCAGCGTGGTTGTAGGAGTTCCTCCATCAGCCAAGATGCTCACCTATGACCCGATGTTGCTCTTCACT
  GGACGCACATGGAAGGGATGTGTCTTTGGAGGTTTGAAAAGCAGAGATGATGTCCCAAAACTAGTGACT
  GAGTTCCTGGCAAAGAAATTTGACCTGGACCAGTTGATAACTCATGTTTTACCATTTAAAAAAATCAGT
  GAAGGATTTGAGCTGCTCAATTCAGGACAAAGCATTCGAACGGTCCTGACGTTTTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_000673
• Insert Size: 1161 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000673.4
• RefSeq Size: 2307 bp
• RefSeq ORF: 1161 bp
• Locus ID: 131
• UniProt ID: P40394
• Cytogenetics: 4q23
• Protein Families: Druggable Genome
• Protein Pathways: Drug metabolism - cytochrome P450, Fatty acid metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Retinol metabolism, Tyrosine metabolism
• MW: 41.5 kDa
• Gene Summary: This gene encodes class IV alcohol dehydrogenase 7 mu or sigma subunit, which is a member of the alcohol dehydrogenase family. Members of this family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. The enzyme encoded by this gene is inefficient in ethanol oxidation, but is the most active as a retinol dehydrogenase; thus it may participate in the synthesis of retinoic acid, a hormone important for cellular differentiation. The expression of this gene is much more abundant in stomach than liver, thus differing from the other known gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
  Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region, compared to variant 1, resulting in an isoform (2) that has a distinct N-terminus and is shorter than isoform 1. CCDS Note: This CCDS representation uses the 5'-most in-frame start codon, which is conserved in higher primates. An alternative downstream start codon, which is more widely conserved and has a stronger Kozak signal, also exists. It is possible that leaky scanning by ribosomes would allow the downstream start codon to be used, at least some of the time. The use of the downstream start codon would result in a protein that is 12 aa shorter at the N-terminus. There is no experimental evidence showing which start codon is preferentially used in vivo.