CDKN3 (NM_005192) Human Untagged Clone

CAT#: SC127857

Reviews ()
Write a review

CDKN3 (untagged)-Human cyclin-dependent kinase inhibitor 3 (CDKN3), transcript variant 1



Reconstitution Protocol

SC127857 is the updated version of SC126488.

USD 462.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CDKN3
Synonyms CDI1; CIP2; KAP; KAP1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_005192, the custom clone sequence may differ by one or more nucleotides


ATGAAGCCGCCCAGTTCAATACAAACAAGTGAGTTTGACTCATCAGATGAAGAGCCTATTGAAGATGAAC
AGACTCCAATTCATATATCATGGCTATCTTTGTCACGAGTGAATTGTTCTCAGTTTCTCGGTTTATGTGC
TCTTCCAGGTTGTAAATTTAAAGATGTTAGAAGAAATGTCCAAAAAGATACAGAAGAACTAAAGAGCTGT
GGTATACAAGACATATTTGTTTTCTGCACCAGAGGGGAACTGTCAAAATATAGAGTCCCAAACCTTCTGG
ATCTCTACCAGCAATGTGGAATTATCACCCATCATCATCCAATCGCAGATGGAGGGACTCCTGACATAGC
CAGCTGCTGTGAAATAATGGAAGAGCTTACAACCTGCCTTAAAAATTACCGAAAAACCTTAATACACTGC
TATGGAGGACTTGGGAGATCTTGTCTTGTAGCTGCTTGTCTCCTACTATACCTGTCTGACACAATATCAC
CAGAGCAAGCCATAGACAGCCTGCGAGACCTAAGAGGATCCGGGGCAATACAGACCATCAAGCAATACAA
TTATCTTCATGAGTTTCGGGACAAATTAGCTGCACATCTATCATCAAGAGATTCACAATCAAGATCTGTA
TCAAGATAA


>OriGene 5' read for NM_005192 unedited
ACGACTCCTATAGGGCGGCCGCGAATTCGGCACCAGGGGGCGCGGGCTCGGCCGGGGCAC
CGGTGAGTCGCCGGCGCTGCAGAGGGAGGCGGCACTGGTCTCGACGTGGGGCGGCCAGCG
ATGAAGCCGCCCAGTTCAATACAAACAAGTGAGTTTGACTCATCAGATGAAGAGCCTATT
GAAGATGAACAGACTCCAATTCATATATCATGGCTATCTTTGTCACGAGTGAATTGTTCT
CAGTTTCTCGGTTTATGTGCTCTTCCAGGTTGTAAATTTAAAGATGTTAGAAGAAATGTC
CAAAAAGATACAGAAGAACTAAAGAGCTGTGGTATACAAGACATATTTGTTTTCTGCACC
AGAGGGGAACTGTCAAAATATAGAGTCCCAAACCTTCTGGATCTCTACCAGCAATGTGGA
ATTATCACCCATCATCATCCAATCGCAGATGGAGGGACTCCTGACATAGCCAGCTGCTGT
GAAATAATGGAAGAGCTTACAACCTGCCTTAAAAATNTACCGAAAACCTTAATACACTGC
TATGGAGGACTTGGGAGATCTTGTCTTGTAGCTGCTTGTCTCCTACTATACCTGTCTGAC
ACAATATCACCAGAGCAAGCCATAGACAGCCTGCGAGACCTAAGAGGATCCGGGGCAATA
CAGACCATCAAGCAATACAATTATCTTCATGAGTTTCGGGACAAATAGCTGCCATCTATC
ATCAAGAGATCACATTCAAATCTGTTCAGGATAAGGATTCAATGCATATNTTGACCGGTC
GGAATGCATTCTTACAAATGGTTGAAGGACACATGTATAACG
>Forward primer walk for NM_005192 unedited
CGATGAAGCCGCCCAGTTCAATACAAACAAGTGAGTTTGACTCATCAGATGAAGAGCCTA
TTGAAGATGAACAGACTCCAATTCATATATCATGGCTATCTTTGTCACGAGTGAATTGTT
CTCAGTTTCTCGGTTTATGTGCTCTTCCAGGTTGTAAATTTAAAGATGTTAGAAGAAATG
TCCAAAAAGATACAGAAGAACTAAAGAGCTGTGGTATACAAGACATATTTGTTTTCTGCA
CCAGAGGGGAACTGTCAAAATATAGAGTCCCAAACCTTCTGGATCTCTACCAGCAATGTG
GAATTATCACCCATCATCATCCAATCGCAGATGGAGGGACTCCTGACATAGCCCGCTGCT
GTGAAATAATGGAAGAGCTTACAACCTGCCCTAAAAATTACCGAAAAACCTTAATACACT
GCTATGGAGGACTTTGGAGATCTTGTCTTGTAGCTGCTTGTCTCCTACTATACCTGTCTG
ACACAATATCACCAGAGCAAGCCATAGACAGCCTGCGAGACCTAAGAGGATCCGGGGCAA
TACAGACCATTCAGCAATACAATTATCTTCATGAGTTTCGGGACAAATTAGCTGCACATC
TATCATCAAGAAGATTCCAATCAAGATCTGTATCAAGATAAAGGAATTTCAATAGCATAT
ATATGAACATGTCTGAAATGTCAGTTCTCTAGCATAATTTGGATTGAAATGAAACCCCCA
GTGTTATCAACTTGAAGTAAATGGTCCTGTGCAGATATTCCTAAGGTTTTTGGCCCNNNC
AAAAANNNAAGAANAAANAACTCCACCCTAATGGGCCCGGGGATGCTGTTTCGGAAAA
Restriction Sites Please inquire     
ACCN NM_005192
Insert Size 850 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005192.2, NP_005183.2
RefSeq Size 836 bp
RefSeq ORF 639 bp
Locus ID 1033
UniProt ID Q16667
Cytogenetics 14q22.2
Protein Families Druggable Genome, Phosphatase
Gene Summary The protein encoded by this gene belongs to the dual specificity protein phosphatase family. It was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (1) encodes the longest isoform (1).
Other products for "CDKN3"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.