YAP1 (NM_006106) Human Untagged Clone

CAT#: SC127739

YAP1 (untagged)-Human Yes-associated protein 1 (YAP1), transcript variant 2

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name YAP1 (NM_006106) Human Untagged Clone
Symbol YAP1
Synonyms COB1; YAP; YAP2; YAP65; YKI
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC127739 sequence for NM_006106 edited (data generated by NextGen Sequencing)
ATGGATCCCGGGCAGCAGCCGCCGCCTCAACCGGCCCCCCAGGGCCAAGGGCAGCCGCCT
TCGCAGCCCCCGCAGGGGCAGGGCCCGCCGTCCGGACCCGGGCAACCGGCACCCGCGGCG
ACCCAGGCGGCGCCGCAGGCACCCCCCGCCGGGCATCAGATCGTGCACGTCCGCGGGGAC
TCGGAGACCGACCTGGAGGCGCTCTTCAACGCCGTCATGAACCCCAAGACGGCCAACGTG
CCCCAGACCGTGCCCATGAGGCTCCGGAAGCTGCCCGACTCCTTCTTCAAGCCGCCGGAG
CCCAAATCCCACTCCCGACAGGCCAGTACTGATGCAGGCACTGCAGGAGCCCTGACTCCA
CAGCATGTTCGAGCTCATTCCTCTCCAGCTTCTCTGCAGTTGGGAGCTGTTTCTCCTGGG
ACACTGACCCCCACTGGAGTAGTCTCTGGCCCAGCAGCTACACCCACAGCTCAGCATCTT
CGACAGTCTTCTTTTGAGATACCTGATGATGTACCTCTGCCAGCAGGTTGGGAGATGGCA
AAGACATCTTCTGGTCAGAGATACTTCTTAAATCACATCGATCAGACAACAACATGGCAG
GACCCCAGGAAGGCCATGCTGTCCCAGATGAACGTCACAGCCCCCACCAGTCCACCAGTG
CAGCAGAATATGATGAACTCGGCTTCAGCCATGAACCAGAGAATCAGTCAGAGTGCTCCA
GTGAAACAGCCACCACCCCTGGCTCCCCAGAGCCCACAGGGAGGCGTCATGGGTGGCAGC
AACTCCAACCAGCAGCAACAGATGCGACTGCAGCAACTGCAGATGGAGAAGGAGAGGCTG
CGGCTGAAACAGCAAGAACTGCTTCGGCAGGAGTTAGCCCTGCGTAGCCAGTTACCAACA
CTGGAGCAGGATGGTGGGACTCAAAATCCAGTGTCTTCTCCCGGGATGTCTCAGGAATTG
AGAACAATGACGACCAATAGCTCAGATCCTTTCCTTAACAGTGGCACCTATCACTCTCGA
GATGAGAGTACAGACAGTGGACTAAGCATGAGCAGCTACAGTGTCCCTCGAACCCCAGAT
GACTTCCTGAACAGTGTGGATGAGATGGATACAGGTGATACTATCAACCAAAGCACCCTG
CCCTCACAGCAGAACCGTTTCCCAGACTACCTTGAAGCCATTCCTGGGACAAATGTGGAC
CTTGGAACACTGGAAGGAGATGGAATGAACATAGAAGGAGAGGAGCTGATGCCAAGTCTG
CAGGAAGCTTTGAGTTCTGACATCCTTAATGACATGGAGTCTGTTTTGGCTGCCACCAAG
CTAGATAAAGAAAGCTTTCTTACATGGTTATAG

Clone variation with respect to NM_006106.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_006106 unedited
CGCGAATTCCGCACCAGGGGCGCAGGGCGGGGGCGGAGGCGCCGGGGCGGGGGATGCGGG
GCCGCGGCGCAACCCCCCGGCCCTGAGAGCGAGGACAGCGCCGCCCGGCCCGCAGCCGTC
GCCGCTTCTCCACCTCGGCCCGTGGAGCCGGGGCGTCCGGGCGTANCCCTCGCTCGCCTG
GGTCAGGGGGTGCGCGTCGGGGGAGGCAGAAGCCATGGATCCCGGGCAGCAGCCGCCGCC
TCAACCGGCCCCCCAGGGCCAAGGGCAGCCGCCTTCGCAGCCCCCGCAGGGGCAGGGCCC
GCCGTCCGGACCCGGGCAACCGGCACCCGCGGCGACCCAGGCGGCGCCGCAGGCACCCCC
CGCCGGGCATCAGATCGTGCACGTCCGCGGGGACTCGGAGACCGACCTGGAGGCGCTCTT
CAACGCCGTCATGAACCCCAAGACGGCCAACGTGCCCCAGACCGTGCCCATGAGGCTCCG
GAAGCTGCCCGACTCCTTCTTCAAGCCGCCGGAGCCCANATCCCACTCCCGACAGGCCAG
TACTGATGCAGGCACTGCAGGAGCCCTGACTCCACAGCATGTTCGAGCTCATTCCTCTCC
AGCTTCTCTGCAGGTGGGAGCTGTTTCTCCTGGGACACTGACCCCCACTGGAGTAGTCTC
TGGCCCAGCAGCTACACCCACAGCTCAGCATCTTCGACAGTCTTCTTTTGAGAACCTGAT
GATGTACCTCTGCCAGCN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_006106 unedited
AGTAATTCGGGTTNATGAACCACATCAGGGACAAATTGAATACATAAGAAAAAAAGTAAA
TTTTATGTAAGTACCTAACATATGAGCATGCTCTTACATCTAAAACAAAAAATAAAAAGG
TAACATTGGTACTATATATATATATTTGACAAGTGTGCATTAAAGAATTCTCTAATATAA
AACATTTAAAATGTGGAGAATACTTTTTTATTATACAGAAAACAATTGTTATGATAGGCA
CACCCACAATTCTTATAACAACATGCTTGCGAGGATAAAATCCACCTGAGCACTCATTTC
ACAGATGTACCAACGCTAGAAAAGTGTTAAGCACTGAATATTGCCACCCACTTTTGCAAT
GTTTGAGTTTCAACACTGATTGGTATGAATTCTGAATTACACAATTAATTACTGTTATTT
TTCAGTCTTTCTGCCATGTTCCATATAGAAGGCATGTATTTAATATGAATACTTAACACA
GCAACATTATTTGTAGCAAAGTCACTTCCCTGTGTTCATTTTTCCTTTAAAGGCACTACA
TTTAGAAAAGGTAATACTACAAAAAGTGCTTTGGAAAATCTGAAACTCCAAATCAATGTG
CTTCATCCACCAAAAGTGTATCTTAGAAGCCCTGACTGAAAATACCCACATGTAAAAGTG
GTTAATTTTAAAGATTTAAAATTGGGTTATTGGTTAAGCAAGTTTAGAATTCCCGTTAAA
ATTTTATTCCAAGGTTTCGCATGTAACCAGAAACGGTGAAGACCCTGTTCCTATGGCATA
AGACGTTTATCAGGTCTCCAGCAGGGCTTTGTTTCCAGTCAAGAGGGAAAGCACTCTGAG
ACTTCTTCAGGTCAATACGTTGAGGTAATTACGACCAATCCTGGCCAGCGGTACC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006106
ORF Size 1365 bp
Insert Size 4700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006106.2, NP_006097
RefSeq Size 5128
RefSeq ORF 1365
Locus ID 10413
Cytogenetics 11q22.1
Domains WW
Protein Families Druggable Genome
Gene Summary This gene encodes a downstream nuclear effector of the Hippo signaling pathway which is involved in development, growth, repair, and homeostasis. This gene is known to play a role in the development and progression of multiple cancers as a transcriptional regulator of this signaling pathway and may function as a potential target for cancer treatment. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2) uses an alternate in-frame splice site and lacks two alternate exons in the coding region, compared to variant 9. The encoded protein (isoform 2) represents the YAP1-1alpha isoform described in Figure 3 of PMID: 22939869. It is shorter, compared to isoform 9.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations