IFRD1 (NM_001550) Human Untagged Clone

CAT#: SC127680

IFRD1 (untagged)-Human interferon-related developmental regulator 1 (IFRD1), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name IFRD1 (NM_001550) Human Untagged Clone
Symbol IFRD1
Synonyms PC4; TIS7
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC127680 sequence for NM_001550 edited (data generated by NextGen Sequencing)
ATGCCGAAGAACAAGAAGCGGAACACTCCCCACCGCGGTAGCAGTGCTGGCGGCGGCGGG
TCAGGAGCAGCCGCAGCGACGGCGGCGACAGCAGGTGGCCAGCATCGAAATGTTCAGCCT
TTTAGTGATGAAGATGCATCAATTGAAACAATGAGCCATTGCAGTGGTTATAGCGATCCT
TCCAGTTTTGCTGAAGATGGACCAGAAGTCCTTGATGAGGAAGGAACTCAAGAAGACCTA
GAGTACAAGTTGAAGGGATTAATTGACCTAACCCTGGATAAGAGTGCGAAGACAAGGCAA
GCAGCTCTTGAAGGTATTAAAAATGCACTGGCTTCAAAAATGCTGTATGAATTTATTCTG
GAAAGGAGAATGACTTTAACTGATAGCATTGAACGCTGCCTGAAAAAAGGTAAGAGTGAT
GAGCAACGTGCAGCTGCAGCGTTAGCATCTGTTCTTTGTATTCAGCTGGGCCCTGGAATT
GAAAGTGAAGAGATTTTGAAAACTCTTGGACCAATCCTAAAGAAAATCATTTGTGATGGG
TCAGCTAGTATGCAGGCTAGGCAAACTTGTGCAACTTGCTTTGGTGTTTGCTGTTTTATT
GCCACAGATGACATTACTGAACTATACTCAACTCTGGAATGTTTGGAAAATATCTTCACT
AAATCCTATCTCAAAGAGAAAGACACTACTGTTATTTGCAGCACTCCTAATACAGTGCTT
CATATCAGCTCTCTTCTTGCATGGACACTACTGCTGACCATATGCCCAATCAATGAAGTG
AAGAAAAAGCTTGAGATGCATTTCCATAAGCTTCCAAGCCTCCTCTCGTGTGATGATGTA
AACATGAGAATAGCTGCTGGTGAATCTTTGGCACTTCTCTTTGAATTGGCCAGAGGAATA
GAGAGTGACTTTTTTTATGAAGACATGGAGTCCTTGACGCAGATGCTTAGGGCCTTGGCA
ACAGATGGAAATAAACACCGGGCCAAAGTGGACAAGAGAAAGCAGCGGTCAGTTTTCAGA
GATGTCCTGAGGGCAGTGGAGGAACGAGATTTTCCAACAGAAACCATTAAATTTGGTCCT
GAACGCATGTATATTGATTGCTGGGTAAAAAAACACACCTATGACACCTTTAAGGAGGTT
CTTGGATCAGGGATGCAGTACCACTTGCAGTCAAATGAATTCCTTCGAAATGTATTTGAA
CTTGGACCCCCAGTGATGCTTGATGCTGCAACGCTTAAAACGATGAAGATTTCTCGTTTC
GAAAGGCATTTATATAACTCTGCAGCCTTCAAAGCTCGAACCAAAGCTAGAAGCAAATGT
CGAGATAAGAGAGCAGATGTTGGAGAATTCTTCTAG

Clone variation with respect to NM_001550.3
828 t=>g;1047 g=>a
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001550 unedited
GCAATTTGTAATACGACTCACTATAGGGGCGGCCGCGAATTCGCACGAGGCCTCGTGCCG
AATTCGGCACGAGGGCCGCTTCTCGACTCTGTTGTTAGCCGAAGACTCGCCTCTCAGCCG
CCCGCCGCACAGACGCACGAGTAAAAAGTGCAGCTCCATCGGCTGATCCTCGCTAAGCTC
CGACTCTGGGCGGCACCGGGCGTCCCACGATGCCGAAGAACAAGAAGCGGAACACTCCCC
ACCGCGGTAGCAGTGCTGGCGGCGGCGGGTCAGGAGCAGCCGCAGCGACGGCGGCGACAG
CAGGTGGCCAGCATCGAAATGTTCAGCCTTTTAGTGATGAAGATGCATCAATTGAAACAA
TGAGCCATTGCAGTGGTTATAGCGATCCTTCCAGTTTTGCTGAAGATGGACCAGAAGTCC
TTGATGAGGAAGGAACTCAAGAAGACCTAGAGTACAAGTTGAAGGGATTAATTGACCTAA
CCCTGGATAAGAGTGCGAAGACAAGGCAAGCAGCTCTTGAAGGTATTAAAAATGCACTGG
CTTCAAAAATGCTGTATGAATTTATTCTGGAAAGGAGAATGACTTTAACTGATAGCATTG
AACGCTGCCTGAAAAAAGGTAAGAGTGATGAGCAACGTGCAGCTGCAGCGTTAGCATCTG
TTCTTTGTATTCAGCTGGGCCCTGGAATTGAAAGTGAAGAGATTTTGAAAACTCTTGGAC
CAATCCTAAAGAAATCATTTGTGATGGGTCAGCTAGTATGCAGGCTANNGCANACTGTGC
AACTTGCTTTGGTGTTTGCTGTTTTATTGCACAGATGACATTACTGGACTATACTNCACT
CTGGNAATGTTTGGAAATATC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001550 unedited
TGGACCGGCGGCCGCAATCTAGAGTCGAGNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
CAGCGGGGAAAAAAAATCTTTATTTCAAAGTAAAATGCACAAAGTCTTATACAGCAAATA
AAATCAGTGTTACTGCTCTCAAATGTTAAGGTTAGCAACCTTTCTGGCATATGCTAATTC
ATCATGAACTCCCAATAGCTGAACTGAATGGCTTTTAAGTACAGCTATAAGGTCTCATGG
TATAATTCCTTTTGTTGATGCCAGTGACAGGATTTTAAAAGCTACATTCCATTAAAAATT
AAAAATACAGCAGCTTTTCCAGGGGAACTAAATCCCAAAATTGTACCCAAAACTCTTGTC
TAAAATATTAAGTTAAATATCTTGCATGTATATATCATTATAGTAAATCAGTATTCTTGA
CAACCACAGTGTAAAAAATTAAACTTTGGCTAATTGTTTTCCCCATCATGAAATCAGTCT
TTTGCTGTCTTCATAAATAAATTATGACCAAACATTACAAATACTTTATACATGTTTACT
GATTTACAGAGAATATTTAATAATCAGAACTCACCAGTTTCAATAGTATTGTACATTAAA
TTATAAGCAATATAACCACTGCTACAAAAGTTATCTAAGTTAATCCAGGATAAAAAACTG
TGTCTAGAGTTTAAATCCTTTGAATTTGAAAAAAAATTGAAATTGGAAAATAGTCTTCAA
GTTCTGAAAATCTAGAAGAATTCTCCACATCTGCTCTCTTATCTCGACATTTGCTTCTAC
CTTTGGTTCGAGCTTTGAAGGCTGCAAAGTTTATAAATGCCTTCCAAACGAGAATCTTAA
TCGTTTTAGCCGTGCAACATCAAGCTCCCTGGGGGTCCAAGTCAAATACATTTCGAGGGA
ATCACTTGACTGCAAGNGGACTGCCTCCCTGT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001550
ORF Size 1356 bp
Insert Size 2290
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001550.2, NP_001541
RefSeq Size 2273
RefSeq ORF 1356
Locus ID 3475
Cytogenetics 7q31.1
Domains IFRD_C, IFRD
Gene Summary This gene is an immediate early gene that encodes a protein related to interferon-gamma. This protein may function as a transcriptional co-activator/repressor that controls the growth and differentiation of specific cell types during embryonic development and tissue regeneration. Mutations in this gene are associated with sensory/motor neuropathy with ataxia. This gene may also be involved in modulating the pathogenesis of cystic fibrosis lung disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010].
Transcript Variant: This variant (1) encodes the longer isoform (1). Both variants 1 and 2 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.