WNT5A (NM_003392) Human Untagged Clone

CAT#: SC126838

Reviews ()
Write a review

WNT5A (untagged)-Human wingless-type MMTV integration site family, member 5A (WNT5A)



  "NM_003392" in other vectors (6)

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name WNT5A (NM_003392) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol WNT5A
Synonyms hWNT5A
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF within SC126838 sequence for NM_003392 edited (data generated by NextGen Sequencing)
ATGAAGAAGTCCATTGGAATATTAAGCCCAGGAGTTGCTTTGGGGATGGCTGGAAGTGCA
ATGTCTTCCAAGTTCTTCCTAGTGGCTTTGGCCATATTTTTCTCCTTCGCCCAGGTTGTA
ATTGAAGCCAATTCTTGGTGGTCGCTAGGTATGAATAACCCTGTTCAGATGTCAGAAGTA
TATATTATAGGAGCACAGCCTCTCTGCAGCCAACTGGCAGGACTTTCTCAAGGACAGAAG
AAACTGTGCCACTTGTATCAGGACCACATGCAGTACATCGGAGAAGGCGCGAAGACAGGC
ATCAAAGAATGCCAGTATCAATTCCGACATCGAAGGTGGAACTGCAGCACTGTGGATAAC
ACCTCTGTTTTTGGCAGGGTGATGCAGATAGGCAGCCGCGAGACGGCCTTCACATACGCG
GTGAGCGCAGCAGGGGTGGTGAACGCCATGAGCCGGGCGTGCCGCGAGGGCGAGCTGTCC
ACCTGCGGCTGCAGCCGCGCCGCGCGCCCCAAGGACCTGCCGCGGGACTGGCTCTGGGGC
GGCTGCGGCGACAACATCGACTATGGCTACCGCTTTGCCAAGGAGTTCGTGGACGCCCGC
GAGCGGGAGCGCATCCACGCCAAGGGCTCCTACGAGAGTGCTCGCATCCTCATGAACCTG
CACAACAACGAGGCCGGCCGCAGGACGGTGTACAACCTGGCTGATGTGGCCTGCAAGTGC
CATGGGGTGTCCGGCTCATGTAGCCTGAAGACATGCTGGCTGCAGCTGGCAGACTTCCGC
AAGGTGGGTGATGCCCTGAAGGAGAAGTACGACAGCGCGGCGGCCATGCGGCTCAACAGC
CGGGGCAAGTTGGTACAGGTCAACAGCCGCTTCAACTCGCCCACCACACAAGACCTGGTC
TACATCGACCCCAGCCCTGACTACTGCGTGCGCAATGAGAGCACCGGCTCGCTGGGCACG
CAGGGCCGCCTGTGCAACAAGACGTCGGAGGGCATGGATGGCTGCGAGCTCATGTGCTGC
GGCCGTGGCTACGACCAGTTCAAGACCGTGCAGACGGAGCGCTGCCACTGCAAGTTCCAC
TGGTGCTGCTACGTCAAGTGCAAGAAGTGCACGGAGATCGTGGACCAGTTTGTGTGCAAG
TAG

Clone variation with respect to NM_003392.3
>OriGene 5' read for NM_003392 unedited
GACCGTCCCCCCAGGCTTAACCCGGTCGCTCCGCTCGGATTCCTCGGCTGCGCTCGCTCG
GGTGGCGACTTCCTCCCCGCGCCCCCTCCCCCTCGCCATGAAGAAGTCCATTGGAATATT
AAGCCCAGGAGTTGCTTTGGGGATGGCTGGAAGTGCAATGTCTTCCAAGTTCTTCCTAGT
GGCTTTGGCCATATTTTTCTCCTTCGCCCAGGTTGTAATTGAAGCCAATTCTTGGTGGTC
GCTAGGTATGAATAACCCTGTTCAGATGTCAGAAGTATATATTATAGGAGCACAGCCTCT
TCTGCAGCCAACTGGCAGGACTTTCTCAAGGACAGAAGAAACTGTGCCACTTGTATCAAG
ACCACATGCAGTACATCCGGAGAAGGCGCGAAGACCGGCATCANANAATGCCAGTATCAA
TTCCNACATCCGAANGTGGAACTGCAGCACTGGGGATAACACCTCCTGTTTTTTGGCAGG
GTGATGCACATAAGCCAGCCGNGANACGGCCTTTNCATACNCCGTGANGCGCAANAGGGG
TGGGNGAACNCCNTTNAACCGNGCCGTGCCCNCNAGGGCNAACCTGTCCCCCTTGCGGNT
GNCANCCGCGGCCGCNNCCCCCAAGGNNCTGCCCCCGGAACTGGTTTTTGGTNGGNTTGT
GNGCGACCACATCCACTATGGNGTCCGCTTTGCCAAGAAGTT
>OriGene 3' read for NM_003392 unedited
GGGGTTTATTAGTTACGTGGCCGCAATCGGGGTTTNGTTTTAATCTTTTTTTTTTGATAA
AATGATTTTATTAGGAAAAGTACAAGATATGAACAAAAATAAATAATCTTTATCTCATTT
CTAGCCCAGCAAATTGTACACTGCATATAAAAATGGTCTAAGATGCAAGTTTCCTCCATT
CCTTTTTTGCTTTTAAAATACTGAGACAGCATTTCAATTCAATATTCTAGGTTCAAACTG
ATACATTAAAAAAAAATCATACCAACCTTTAATCATTCTACATCCATTTTTTAAAGTTAG
CTAACACGATGATGTTTCACTAAAATAAAATATCCAATCATCAGATTAAAGTGTAAAGTT
TGCGTGAACAGGGAAATTACATCATTGCTCTAAGTTTTAATTCCTATGTTTCTGAATGTT
TTTTGAATTAAAAATTCATTTCATCATCTTACTTTCCAAACACGGGTTCTCTCTTTCACC
ATTCCACAGAGAGAGAAAAGACTAGAAAATACTTTAAAAAAAATAATTATTTCAAAAGTA
TTACTTACAGTGACCATCGGACACTTTTAGACTCGTGCCTTTGTGCCCATTTGCATTAAC
TGGCTGCTTCATGTCACTACTACCCCTTCTATCTCTTCCATTTATTCCGGGCCCCCAAGT
GCCTCGTAGAATGAGGCTGATAACGATTCTTCGCGAGCCAGCTCTTACTCGGCCTTTTAA
TGAAGCAGATTTACCTCTGGCTTCGCCGCGAACGACGGATACGTCCAGGGGGTTTCGACC
CGCTTCCGCCAACCTCCATTAACGCCGGGGCTTTGGCCACGTTTTTCCTAGGCCAACGAT
TCCCGGGAGCGGACCGGAGAGCCNACCCCCCGGTGGCCACCCGGGGGCGCGGGCCCGCCA
CCACACCCCCCCCCACCACCCACA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003392
Insert Size 6000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003392.3, NP_003383.2
RefSeq Size 5855 bp
RefSeq ORF 1143 bp
Locus ID 7474
Cytogenetics 3p14.3
Domains wnt
Protein Families Adult stem cells, Cancer stem cells, Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein, Stem cell relevant signaling - Wnt Signaling pathway
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
Gene Summary The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Citations (2)

Other Versions

Other products for "WNT5A"
Frequently bought together (2)
Rabbit Polyclonal Anti-WNT5A Antibody
    • 100 ul

USD 375.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools