IDO1 (NM_002164) Human Untagged Clone

CAT#: SC126221

IDO1 (untagged)-Human indoleamine 2,3-dioxygenase 1 (IDO1)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name IDO1 (NM_002164) Human Untagged Clone
Symbol IDO1
Synonyms IDO; IDO-1; INDO
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002164 edited
AAACTCTTCAGACACTGAGGGGCACCAGAGGAGCAGACTACAAGAATGGCACACGCTATG
GAAAACTCCTGGACAATCAGTAAAGAGTACCATATTGATGAAGAAGTGGGCTTTGCTCTG
CCAAATCCACAGGAAAATCTACCTGATTTTTATAATGACTGGATGTTCATTGCTAAACAT
CTGCCTGATCTCATAGAGTCTGGCCAGCTTCGAGAAAGAGTTGAGAAGTTAAACATGCTC
AGCATTGATCATCTCACAGACCACAAGTCACAGCGCCTTGCACGTCTAGTTCTGGGATGC
ATCACCATGGCATATGTGTGGGGCAAAGGTCATGGAGATGTCCGTAAGGTCTTGCCAAGA
AATATTGCTGTTCCTTACTGCCAACTCTCCAAGAAACTGGAACTGCCTCCTATTTTGGTT
TATGCAGACTGTGTCTTGGCAAACTGGAAGAAAAAGGATCCTAATAAGCCCCTGACTTAT
GAGAACATGGACGTTTTGTTCTCATTTCGTGATGGAGACTGCAGTAAAGGATTCTTCCTG
GTCTCTCTATTGGTGGAAATAGCAGCTGCTTCTGCAATCAAAGTAATTCCTACTGTATTC
AAGGCAATGCAAATGCAAGAACGGGACACTTTGCTAAAGGCGCTGTTGGAAATAGCTTCT
TGCTTGGAGAAAGCCCTTCAAGTGTTTCACCAAATCCACGATCATGTGAACCCAAAAGCA
TTTTTCAGTGTTCTTCGCATATATTTGTCTGGCTGGAAAGGCAACCCCCAGCTATCAGAC
GGTCTGGTGTATGAAGGGTTCTGGGAAGACCCAAAGGAGTTTGCAGGGGGCAGTGCAGGC
CAAAGCAGCGTCTTTCAGTGCTTTGACGTCCTGCTGGGCATCCAGCAGACTGCTGGTGGA
GGACATGCTGCTCAGTTCCTCCAGGACATGAGAAGATATATGCCACCAGCTCACAGGAAC
TTCCTGTGCTCATTAGAGTCAAATCCCTCAGTCCGTGAGTTTGTCCTTTCAAAAGGTGAT
GCTGGCCTGCGGGAAGCTTATGACGCCTGTGTGAAAGCTCTGGTCTCCCTGAGGAGCTAC
CATCTGCAAATCGTGACTAAGTACATCCTGATTCCTGCAAGCCAGCAGCCAAAGGAGAAT
AAGACCTCTGAAGACCCTTCAAAACTGGAAGCCAAAGGAACTGGAGGCACTGATTTAATG
AATTTCCTGAAGACTGTAAGAAGTACAACTGAGAAATCCCTTTTGAAGGAAGGTTAATGT
AACCCAACAAGAGCACATTTTATCATAGCAGAGACATCTGTATGCATTCCTGTCATTACC
CATTGTAACAGAGCCACAAACTAATACTATGCAATGTTTTACCAATAATGCAATACAAAA
GACCTCAAAATACCTGTGCATTTCTTGTAGGAAAACAACAAAAGGTAATTATGTGTAATT
ATACTAGAAGTTTTGTAATCTGTATCTTATCATTGGAATAAAATGACATTCAATAAATAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002164 unedited
ATGATTTGTATACCACTCTTATAGGCGGACCGCGATTCAGATCTGGTACCGGTCCGGAAT
TCCCGGGATAAAACTCTTCAGACACTGAGGGGCACCAGAGGAGCAGACTACAAGAATGGC
ACACGCTATGGAAAACTCCTGGACAATCAGTAAAGAGTACCATATTGATGAAGAAGTGGG
CTTTGCTCTGCCAAATCCACAGGAAAATCTACCTGATTTTTATAATGACTGGATGTTCAT
TGCTAAACATCTGCCTGATCTCATAGAGTCTGGCCAGCTTCGAGAAAGAGTTGAGAAGTT
AAACATGCTCAGCATTGATCATCTCACAGACCACAAGTCACAGCGCCTTGCACGTCTAGT
TCTGGGATGCATCACCATGGCATATGTGTGGGGCAAAGGTCATGGAGATGTCCGTAAGGT
CTTGCCAAGAAATATTGCTGTTCCTTACTGCCAACTCTCCAAGAAACTGGAACTGCCTCC
TATTTTGGTTTATGCAGACTGTGTCTTGGCAAACTGGAAGAAAAAGGATCCTAATAAGCC
CCTGACTTATGAGAACATGGACGTTTTGTTCTCATTTCGTGATGGAGACTGCAGTAAAGG
ATTCTTCCTGGTCTCTCTATTGGTGGAATAGCAGCTGCTTCTGCAATCAAAGTAATTCCT
ACTGTATTCAAGCAATGCAAATGCAAGAACGGGACACTTTGCTAAAGGCGCTGNTGGAAA
TAGCCTCTTGCTTGGAGAAAGCCCTTCAGTGTTTCACCAATCCACGATCATGTGACCCAA
AGCTTTTTTCAGGGTCCTCGCTATATTTGGCTGGCTGGAAGGGAACCCCACTTTCAAACG
TCTGGTGTATAAAGGGTTTTGGAAACCCAAGGAATTGCAGGGGAATGAAGGCCAACAACG
TCTTCAAGGTTTGACGCCCGGTGGGCATCCCAGACGGT
Tag Tag Free
ACCN NM_002164
ORF Size 1212 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002164.3, NP_002155
RefSeq Size 1655
RefSeq ORF 1212
Locus ID 3620
Cytogenetics 8p11.21
Protein Families Druggable Genome
Protein Pathways Tryptophan metabolism, Metabolic pathways
Gene Summary This gene encodes indoleamine 2,3-dioxygenase (IDO) - a heme enzyme that catalyzes the first and rate-limiting step in tryptophan catabolism to N-formyl-kynurenine. This enzyme acts on multiple tryptophan substrates including D-tryptophan, L-tryptophan, 5-hydroxy-tryptophan, tryptamine, and serotonin. This enzyme is thought to play a role in a variety of pathophysiological processes such as antimicrobial and antitumor defense, neuropathology, immunoregulation, and antioxidant activity. Through its expression in dendritic cells, monocytes, and macrophages this enzyme modulates T-cell behavior by its peri-cellular catabolization of the essential amino acid tryptophan.[provided by RefSeq, Feb 2011].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations