ACCN1 (ASIC2) (NM_001094) Human Untagged Clone

CAT#: SC124011

Reviews ()
Write a review

ASIC2 (untagged)-Human amiloride-sensitive cation channel 1, neuronal (ACCN1), transcript variant 2

  View "NM_001094" in other vectors (10)

Reward yourself with an Amazon® Card when get any 3 cDNA clones.

USD 740.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name ACCN1 (ASIC2) (NM_001094) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol ASIC2
Synonyms ACCN; ACCN1; ASIC2a; BNaC1; BNC1; hBNaC1; MDEG
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001094, the custom clone sequence may differ by one or more nucleotides


ATGGACCTCAAGGAAAGCCCCAGTGAGGGCAGCCTGCAACCTTCTAGCATCCAGATCTTTGCCAACACCT
CCACCCTCCATGGCATCCGCCACATCTTCGTGTATGGGCCGCTGACCATCCGGCGTGTGCTGTGGGCAGT
GGCCTTCGTGGGCTCTCTGGGCCTGCTGCTGGTGGAGAGCTCTGAGAGGGTGTCCTACTACTTCTCCTAC
CAGCATGTCACTAAGGTGGACGAAGTGGTGGCTCAAAGCCTGGTCTTCCCAGCTGTGACCCTCTGTAACC
TGAATGGCTTCCGGTTCTCCAGGCTCACCACCAATGACCTGTACCATGCTGGGGAGCTGCTGGCCCTGCT
GGATGTCAACCTGCAGATCCCGGACCCCCATCTGGCTGACCCCTCCGTGCTGGAGGCCCTGCGGCAGAAG
GCCAACTTCAAGCACTACAAACCCAAGCAGTTCAGCATGCTGGAGTTCCTGCACCGTGTGGGCCATGACC
TGAAGGATATGATGCTCTACTGCAAGTTCAAAGGGCAGGAGTGCGGCCACCAAGACTTCACCACAGTGTT
TACAAAATATGGGAAGTGTTACATGTTTAACTCAGGCGAGGATGGCAAACCTCTGCTCACCACGGTCAAG
GGGGGGACAGGCAACGGGCTGGAGATCATGCTGGACATTCAGCAGGATGAGTACCTGCCCATCTGGGGAG
AGACAGAGGAAACGACATTTGAAGCAGGAGTGAAAGTTCAGATCCACAGTCAGTCTGAGCCACCTTTCAT
CCAAGAGCTGGGCTTTGGGGTGGCTCCAGGGTTCCAGACCTTTGTGGCCACACAGGAGCAGAGGCTCACA
TACCTGCCCCCACCGTGGGGTGAGTGCCGATCCTCAGAGATGGGCCTCGACTTTTTTCCTGTTTACAGCA
TCACCGCCTGTAGGATTGACTGTGAGACCCGCTACATTGTGGAAAACTGCAACTGCCGCATGGTTCACAT
GCCAGGGGATGCCCCTTTTTGTACCCCTGAGCAGCACAAGGAGTGTGCAGAGCCTGCCCTAGGTCTGTTG
GCGGAAAAGGACAGCAATTACTGTCTCTGCAGGACACCCTGCAACCTAACCCGCTACAACAAAGAGCTCT
CCATGGTGAAGATCCCCAGCAAGACATCAGCCAAGTACCTTGAGAAGAAATTTAACAAATCAGAAAAATA
TATCTCAGAGAACATCCTTGTTCTGGATATATTTTTTGAAGCTCTCAATTATGAGACAATTGAACAGAAG
AAGGCGTATGAAGTTGCTGCCTTACTTGGTGATATTGGTGGTCAGATGGGATTGTTCATTGGTGCTAGTA
TCCTTACAATACTAGAGCTCTTTGATTATATTTATGAGCTGATCAAAGAGAAGCTATTAGACCTGCTTGG
CAAAGAGGAGGACGAAGGGAGCCACGATGAGAATGTGAGTACTTGTGACACAATGCCAAACCACTCTGAA
ACCATCAGTCACACTGTGAACGTGCCCCTGCAGACGACCCTGGGGACCTTGGAGGAGATTGCCTGCTGA


>OriGene 5' read for NM_001094 unedited
GGTTAGCGGTCACTATAGGGNCGGCCGCGCNNNNNNNGGAGCATCACCCTGATGTCTCCC
CAAGAAAAACCAGCCGTGCTTATCGCCTGGAAAAAATCAAGAGCTAGAGGGTGAATGGGT
TAGGGGTAAACGGGGACCCCTGTCAACGTGATAAAGGCTCTCAGGATAAACTCACAGCAT
CTGGCGCGATGCTTGCCTTGCGTTCTCTCCCCTGAACGTCAAGGTTTAAGCAGAGCCCGA
GGACTGGGAGCTCTTCTCTGAAATTCGATCAACCTGAAGCCAGTTGCGGAACTGCACGGG
GTCCCGATGGACCTCAAGGAAAGCCCCAATGAGGGCAGCCTGCAACCTTCTAGCATCCAG
ATCTTTGCCAACACCTCCACCCTCCATGGCATCCGCCACATCTTCGTGTATGGGCCGCTG
ACCATCCGGCGTGTGCTGTGGGCAATGGCCTTCGTGGGCTCTCTGGGCCTGCTGCTGGTG
GAGAGCTCTGAGAGGGTGTCCTACTACTTCTCCTACCAGCATGTCACTAAGGTGGACGAA
GTGGTGGCTCAAAACCCGGTCTTCCCAGCTGTGACCCTCTGGAACCTGAATGGCTTCCGG
GTCTCCAGGCTCACCACCCAAAGACCTGTACCATGCTGGGGAGCTGCTGGCCCTGCTGAT
GTCAACCTGCAGATCCCGGACCCCCATCTGGCTGACCCCTCCCTGCTGGAAGCCCTGCGG
CAGAAAGCCACG
>OriGene 3' read for NM_001094 unedited
CTTCTCTCGTGGCTCCCTTCGTCCTAGGTNNGNGAAGCAGGTCTAATAGCTTCTCTTTGA
TCAGCTCATAAATATTTTCAAAGAGCTCTAGTATTGTAAGGATACTAGCGCCAATGAACA
ATCCCATCTGACCACCAATATCACCAATAATAGCAGCAACTTCATACGCCTTCTTCTGTT
CAATTGTCTCATAATTGAGAGCTTCAAAAAATATATCCAGAACAAGGATGTTCTCTGAGA
TATATTTTTCTGATTTGTTAAATTTCTTCTCAAGGTACTTGGCTGATGTCTTGCTGGGGA
TCTTCACCATGGAGAGCTCTTTGTTGTAACGGGTTAAGTTGCAAGGTGTCCTGCAGAGAC
AGTAATTGCTGTCCTTTTCCGCCAACAGACCTAGGGCAGGCTCTGCACACTCCTTGTGCT
GCTCAGGGGTACAAAANAGGGCATCCCCTGGCATGTGAACCATGCGGCAGTTGCAGTTTT
CCACAATGTAGCGGGTCTCACAGTCAATCCTACAGGCGGTGATGCTGTAAACAGGAAAAA
AGTCCAGGCCCATCTCTGAGGATCGGCACTCACCCCACGGGGGGGGCAAGGTATGTAAGC
CCTCTGCTCCCTGTGTGGCCACAAAGGTCTGGAACCCTGGAACCCACCCCAAACCCAACT
CTTGGATGAAAGGTGGCTAAGACTGACTGTGGATCTGAACTTTAACTCCTGCTTCAAATG
TCGTTTCCTCTGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001094
ORF Size 1539 bp
Insert Size 3500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001094.4, NP_001085.2
RefSeq Size 2747
RefSeq ORF 1539
Locus ID 40
Cytogenetics 17q11.2-q12
Protein Families Druggable Genome, Ion Channels: Other
Protein Pathways Taste transduction
Gene Summary This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, 2 hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene may play a role in neurotransmission. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 3 has been observed to co-assemble into proton-gated channels sensitive to gadolinium. Alternative splicing has been observed at this locus and two variants, encoding distinct isoforms, have been identified. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (MDEG1) uses an alternate 5'-terminal exon, compared to variant MDEG2, resulting in a shorter isoform (MDEG1) with a distinct N-terminus, compared to isoform MDEG2.

Other Versions

Other products for "ASIC2"
Frequently bought together (2)
Rabbit Polyclonal Anti-ACCN1 Antibody
    • 100 ul

USD 360.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones