Estrogen Receptor beta(ESR2) (NM_001437) Human Untagged Clone

CAT#: SC119216

ESR2 (untagged)-Human estrogen receptor 2 (ER beta) (ESR2), transcript variant a

USD 845.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Estrogen Receptor beta(ESR2) (NM_001437) Human Untagged Clone
Symbol ESR2
Synonyms ER-BETA; Erb; ESR-BETA; ESRB; ESTRB; NR3A2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001437 edited
AACAAAATATTAACGCTTACAATTTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGT
GCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACG
CCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTGATCTATACATTGAATCAAT
ATTGGCAATTAGCCATATTAGTCATTGGTTATATAGCATAAATCAATATTGGCTATTGGCCATTGCATAC
GTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACCGCCATGTTGACATTGA
TTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCG
TTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAAT
GACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAA
ACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTA
AATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGT
ATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGTTTGAC
TCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGG
ACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGT
CTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGG
TGTGTTTATCTGCAAGCCATTATACTTGCCCACGAATCTTTGAGAACATTATAATGACCTTTGTGCCTCT
TCTTGCAAGGTGTTTTCTCAGCTGTTATCTCAAGACATGGATATAAAAAACTCACCATCTAGCCTTAATT
CTCCTTCCTCCTACAACTGCAGTCAATCCATCTTACCCCTGGAGCACGGCTCCATATACATACCTTCCTC
CTATGTAGACAGCCACCATGAATATCCAGCCATGACATTCTATAGCCCTGCTGTGATGAATTACAGCATT
CCCAGCAATGTCACTAACTTGGAAGGTGGGCCTGGTCGGCAGACCACAAGCCCAAATGTGTTGTGGCCAA
CACCTGGGCACCTTTCTCCTTTAGTGGTCCATCGCCAGTTATCACATCTGTATGCGGAACCTCAAAAGAG
TCCCTGGTGTGAAGCAAGATCGCTAGAACACACCTTACCTGTAAACAGAGAGACACTGAAAAGGAAGGTT
AGTGGGAACCGTTGCGCCAGCCCTGTTACTGGTCCAGGTTCAAAGAGGGATGCTCACTTCTGCGCTGTCT
GCAGCGATTACGCATCGGGATATCACTATGGAGTCTGGTCGTGTGAAGGATGTAAGGCCTTTTTTAAAAG
AAGCATTCAAGGACATAATGATTATATTTGTCCAGCTACAAATCAGTGTACAATCGATAAAAACCGGCGC
AAGAGCTGCCAGGCCTGCCGACTTCGGAAGTGTTACGAAGTGGGAATGGTGAAGTGTGGCTCCCGGAGAG
AGAGATGTGGGTACCGCCTTGTGCGGAGACAGAGAAGTGCCGACGAGCAGCTGCACTGTGCCGGCAAGGC
CAAGAGAAGTGGCGGCCACGCGCCCCGAGTGCGGGAGCTGCTGCTGGACGCCCTGAGCCCCGAGCAGCTA
GTGCTCACCCTCCTGGAGGCTGAGCCGCCCCATGTGCTGATCAGCCGCCCCAGTGCGCCCTTCACCGAGG
CCTCCATGATGATGTCCCTGACCAAGTTGGCCGACAAGGAGTTGGTACACATGATCAGCTGGGCCAAGAA
GATTCCCGGCTTTGTGGAGCTCAGCCTGTTCGACCAAGTGCGGCTCTTGGAGAGCTGTTGGATGGAGGTG
TTAATGATGGGGCTGATGTGGCGCTCAATTGACCACCCCGGCAAGCTCATCTTTGCTCCAGATCTTGTTC
TGGACAGGGATGAGGGGAAATGCGTAGAAGGAATTCTGGAAATCTTTGACATGCTCCTGGCAACTACTTC
AAGGTTTCGAGAGTTAAAACTCCAACACAAAGAATATCTCTGTGTCAAGGCCATGATCCTGCTCAATTCC
AGTATGTACCCTCTGGTCACAGCGACCCAGGATGCTGACAGCAGCCGGAAGCTGGCTCACTTGCTGAACG
CCGTGACCGATGCTTTGGTTTGGGTGATTGCCAAGAGCGGCATCTCCTCCCAGCAGCAATCCATGCGCCT
GGCTAACCTCCTGATGCTCCTGTCCCACGTCAGGCATGCGAGTAACAAGGGCATGGAACATCTGCTCAAC
ATGAAGTGCAAAAATGTGGTCCCAGTGTATGACCTGCTGCTGGAGATGCTGAATGCCCACGTGCTTCGCG
GGTGCAAGTCCTCCATCACGGGGTCCGAGTGCAGCCCGGCAGAGGACAGTAAAAGCAAAGAGGGCTCCCA
GAACCCACAGTCTCAGTGA
CTCGACTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCG
GGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAG
CCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGG
AGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAAC
CAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCT
GCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGG
TAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTT
GGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTTCTGATTTTAAAATA
ACTATACCAGCAGGAGGACGTCCAGACACAGCATAGGCTACCTGGCCATGCCCAACCGGTGGGACATTTG
AGTTGCTTGCTTGGCACTGTCCTCTCATGCGTTGGGTCCACTCAGTAGATGCCTGTTGAATTGGGTACGC
GGCCAGCTTGGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAG
TATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGA
AGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCC
TAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGA
GGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAA
AAGCTCCTCGAGGAACTGAAAAACCAGAAAGTTAATTCCCTATAGTGAGTCGTATTAAATTCGTAATCAT
GTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATA
AAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTT
TCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCG
TATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTA
TCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAG
CAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCC
CCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATAC
CAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGT
CCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTA
GGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGT
AACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGA
TTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAG
AAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGA
TCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAA
AAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTA
AGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTT
AAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTA
TCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACG
GGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTA
TCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCC
AGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGC
CATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGA
TCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTG
TCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCAT
GCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGG
CGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGC
TCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGAT
GTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAA
ACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCC
TTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTA
GAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGC
GCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCG
CTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGG
GCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGT
TCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATA
GTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGAT
TTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAA
ATATT
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001437 unedited
TTTGGGCCCAAGTATCANNAATATTTGTNAATACGNACTTCACTNTCAGGGNNCGGCGCG
CGGCTGGCTGTTTATGCTGACAAGTCCATTGATACCTTGCACCACGCAATCTTTGAAGAA
CATTATAATGACCTTTGTGCCTCTTCTTGCAAGGTGTTTTCTCAGCTGTTATCTCAAGAC
ATGGATATAAAAAACTCACCATCTAGCCTTAATTCTCCTTCCTCCTACAACTGCAGTCAA
TCCATCTTACCCCTGGAGCACGGCTCCATATACATACCTTCCTCCTATGTAGACAGCCAC
CATGAATATCCAGCCATGACATTCTATAGCCCTGCTGTGATGAATTACAGCATTCCCAGC
AATGTCACTAACTTGGAAGGTGGGCCTGGTCGGCAGACCACAAGCCCAAATGTGTTGTGG
CCAACACCTGGGCACCTTTCTCCTTTAGTGGTCCATCGCCAGTTATCACATCTGTATGCG
GAACCTCAAAAGAGTCCCTGGTGTGAAGCAAGATCGCTAGAACACACCTTACCTGTAAAC
AGAGAGACACTGAAAAGGAAGGTTAGTGGGAACCGTTGCGCCAGCCCTGTTACTGGTCCA
GGTTCAAAGAGGGATGCTCACTTCTGCGCTGTCTGCAGCGATTACGCATCGGGATATCAC
TATGGAGTCTGGTCGTGTGAAGGATGTAAGGCCTTTTTTAAAAGAAGCATTCAAGGACAT
AATGATTATATTTGTCCAGCTACAAATCAGTGTACAATCGATAATAACCGGCGCAAGAGC
TGNCCAGCCTGCCGACTTTCGAAGTGTTACGAAGTGGCATGGGTGGAGTGTGGCTCCTNG
AAGAGAGATGTGGTACCGNCTTTGTGCGAACAGNAAAGTGCCGACAAGCGCTGCACTGTG
CCNGCTAGGCAAA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001437 unedited
ANAGCACTGCGGNAGGGTCACAGGATGCCACCCGGGCTCTGTTCAGGAAACAGCTATGAC
CGCGGCCGCAATCTAGAGTCGAGTCACTGAGACTGTGGGTTCTGGGAGCCCTCTTATGCT
TTTACTGTCCTCTGCCGGGCTGCACTCGGACCCCGTGATGGAGGACTTGCACCCGCGAAG
CACGTGGGCATTCAGCATCTCCAGCAGCAGGTCATACACTGGGACCACATTTTTGCACTT
CATGTTGAGCAGATGTTCCATGCCCTTGTTACTCGCATGCCTGACGTGGGACAGGAGCAT
CAGGAGGTTAGCCAGGCGCATGGATTGCTGCTGGGAGGAGATGCCGCTCTTGGCAATCAC
CCAAACCAAAGCATCGGTCACGGCGTTCAGCAAGTGAGCCAGCTTCCGGCTGCTGTCAGC
ATCCTGGGTCGCTGTGACCAGAGGGTACATACTGGAATTGAGCAGGATCATGGCCTTGAC
ACAGAGATATTCTTTGTGTTGGAGTTTTAACTCTCGAAACCTTGAAGTAGTTGCCAGGAG
CATGTCAAAGATTTCCAGAATTCCTTCTACGCATTTCCCCTCATCCCTGTCCAGAACAAG
ATCTGGAGCAAAGATGAGCTTGCCGGNGTGGTCAATTGAGCGCCACATCAGCCCCATCAT
TAACACCTCCATCCAACAGCTCTCCAAGAGCCGCACTTGGTCGAACAGGCTGAGCTCCAC
AAAGCCGGGTATCTTCTTGGCCCAGCTGATCATGTGTACCAACTCCTTGTNCGCCAACTT
GGTCAGGGACATCATCATGGAGGCCCTCGTGAAGGGCGCACTGGNGC
Tag Tag Free
ACCN NM_001437
ORF Size 1593 bp
Insert Size 1800
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001437.1, NP_001428
RefSeq Size 2011
Locus ID 2100
Cytogenetics 14q23.2-q23.3
Domains HOLI, zf-C4
Protein Families Nuclear Hormone Receptor, Transcription Factors, Druggable Genome
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations