DLST (NM_001933) Human Untagged Clone

CAT#: SC118954

DLST (untagged)-Human dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (DLST), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name DLST (NM_001933) Human Untagged Clone
Symbol DLST
Synonyms DLTS
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC118954 sequence for NM_001933 edited (data generated by NextGen Sequencing)
ATGCTGTCCCGATCCCGCTGTGTGTCTCGGGCGTTCAGCCGCTCGCTCTCCGCCTTCCAG
AAGGGGAACTGCCCTCTAGGGAGACGTTCCCTGCCTGGGGTCTCCTTATGCCAGGGACCA
GGTTACCCTAACAGCAGGAAGGTTGTCATTAACAACAGTGTCTTCAGTGTTCGCTTTTTC
AGAACTACAGCTGTATGCAAGGATGACTTGGTTACAGTCAAAACCCCAGCGTTTGCAGAA
TCTGTCACAGAGGGAGATGTCAGGTGGGAGAAAGCTGTTGGAGACACAGTTGCAGAAGAT
GAAGTGGTTTGTGAGATTGAAACTGACAAGACATCTGTGCAGGTTCCATCACCAGCAAAT
GGCGTGATTGAAGCTCTTTTGGTACCTGATGGGGGAAAAGTCGAAGGAGGCACTCCACTT
TTCACACTCAGGAAAACTGGTGCTGCTCCTGCTAAGGCCAAGCCGGCTGAAGCTCCTGCT
GCTGCAGCCCCAAAAGCAGAACCTACAGCAGCGGCAGTTCCTCCCCCTGCAGCACCCATA
CCCACTCAGATGCCACCGGTGCCCTCGCCCTCACAACCTCCTTCTGGCAAACCTGTGTCT
GCAGTAAAACCCACTGTTGCCCCACCACTAGCTGAGCCAGGAGCTGGCAAAGGTCTGCGT
TCAGAACATCGGGAGAAAATGAACAGGATGCGGCAGCGCATTGCTCAGCGTCTGAAGGAG
GCCCAGAATACATGTGCAATGCTGACAACTTTTAATGAGATTGACATGAGTAACATCCAG
GAGATGAGGGCTCGGCACAAAGAGGCTTTTTTGAAGAAACATAACCTCAAACTAGGCTTC
ATGTCGGCATTTGTGAAGGCCTCAGCCTTTGCCTTGCAGGAACAGCCTGTTGTAAATGCA
GTGATTGACGACACAACCAAAGAGGTGGTGTATAGGGATTATATTGACATCAGTGTTGCA
GTGGCCACCCCACGGGGTCTGGTGGTTCCAGTCATCAGGAATGTGGAAGCTATGAATTTT
GCAGATATTGAACGGACCATCACTGAACTGGGAGAGAAGGCCCGAAAGAATGAACTTGCC
ATTGAAGATATGGATGGTGGTACCTTCACCATTAGCAATGGAGGCGTTTTTGGCTCGCTC
TTTGGAACACCCATTATCAACCCCCCTCAGTCTGCCATCCTGGGGATGCATGGCATCTTT
GACAGGCCAGTGGCTATAGGAGGCAAGGTAGAGGTGCGGCCCATGATGTACGTGGCACTG
ACCTATGATCACCGGCTGATTGATGGCAGAGAGGCTGTGACTTTCCTCCGCAAAATCAAG
GCAGCGGTAGAGGATCCCAGAGTCCTCCTCCTGGATCTTTAG

Clone variation with respect to NM_001933.4
576 g=>a;1098 c=>t
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001933 unedited
AGTATTTTGTAATACGACTCACTATAGGGCGGCCCGCGATTCGGCACGAGGGCCCGCCCT
CGGCTCCTCCGCCGTGATGCTGTCCCGATCCCGCTGTGTGTCTCGGGCGTTCAGCCGCTC
GCTCTCCGCCTTCCAGAAGGGGAACTGCCCTCTAGGGAGACGTTCCCTGCCTGGGGTCTC
CTTATGCCAGGGACCAGGTTACCCTAACAGCAGGAAGGTTGTCATTAACAACAGTGTCTT
CAGTGTTCGCTTTTTCAGAACTACAGCTGTATGCAAGGATGACTTGGTTACAGTCAAAAC
CCCAGCGTTTGCAGAATCTGTCACAGAGGGAGATGTCAGGTGGGAGAAAGCTGTTGGAGA
CACAGTTGCAGAAGATGAAGTGGTTTGTGAGATTGAAACTGACAAGACATCTGTGCAGGT
TCCATCACCAGCAAATGGCGTGATTGAAGCTCTTTTGGTACCTGATGGGGGAAAAGTCGA
AGGAGGCACTCCACTTTTCACACTCAGGAAAACTGGTGCTGCTCCTGCTAAGGCCAAGCC
GGCTGAAGCTCCTGCTGCTGCAGCCCCAAAAGCAGAACCTACAGCAGCGGCAGTTCCTCC
CCCTGCAGCACCCATACCCACTCAGATGCCACCGGTGCCCTCGCCCTCACAACCTNCTTC
TGGCAAACCTGTGTCTGCAGTAAAACCCACTGTTGCCCCACCACTAGCTGAGCCAGGAGC
TGGCAAGGTCTGCGTTCAGACATCGGGAGAAAAGAACAGATGCGGCAGCGCATTGCTCAC
CGTCTGAAGGAGGCCCAGATACATGTGCAATGCTGACACCTTTTATGAAGATGACATGAG
TAACATCCAGAAGATGAGGGCTCGGCACAC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001933 unedited
GCTATGCACCGGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTGAGAAATCT
GCCCTTTAATTTGCATTTAAAATCAGTTTCTTTAAATACTTTAGTTACAAGTTCTGAATA
GTGAAGACAGAGTAGTAGATGCTGCAGGCACTCAGTATTGGCTCCCACCCCTTCCCCCCT
CCCCCACCCCCAGGCCTCACTTCTTGGCTTAAGATACAAAAGGGCACTCTCTACTGGCCC
TGGTGTCAAACGTCAGCAGCCTCAGGCCTGGATGCAGTTGGATACAAAGCCATGAATCCC
AGTGGCTCCAAGGAATTCCAATGATTGTGCCCAGATCCACGGGCAACACACCTTAGAAAT
GACCTCATCCGTTTCACCACTAGGTACTAACACCCTCAGGGTGGTTTCCTACCCCAGTCC
ACGTCCTCCAGATCTGTGTTCTGCACAGGAAGAGACAAGGCCCCGTTATAACGCACGAAG
GAACAAACCCTGCCCCCTCATCCCCGCTGCTTCCCGCTACCTCAACTGCACACCCCAAGG
CACTGCGACGCCACTCTAGACGGCACCCCCCCTCCCCCATTCCCCACCCCCCTTTTGCCC
CCTTTCTGGACATCCTCTCGCCCCCCCGCCCTCATTCGCTCCACACCCCCCTTTCCATCA
ATCGGCCCCACCGAGGCCCACCCTCTCTTTTGGGCTCTCTACGGCCCTTCCCCCCCCTCA
CCGCCACCGCAGTCCCCTTGTTTATTCTTCGTTTCCCCCCCCATTATCCCCCCCTTCCCC
TCCTCCCCACCTTTTCCCTCCCCCCACTCCTTTCCCCCCCGCCCCCATTTTTCTTCCCAC
TATTCCCGCCCCCGTCCCCCCCTATTTTCCTCCCTTTTCCACGCCCCCCCTGCTCTTCAC
TCTCTCCCTTCTTCTTCGTCCCTCCCCCCACGTTTATCCCCCCCACCTCCCTTTTCCCCC
CCTCTCCTTCAGCCCTTCTCTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001933
ORF Size 1362 bp
Insert Size 3000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001933.3, NP_001924
RefSeq Size 2828
Locus ID 1743
Cytogenetics 14q24.3
Domains biotin_lipoyl, 2-oxoacid_dh
Protein Pathways Citrate cycle (TCA cycle), Lysine degradation, Metabolic pathways
Gene Summary The 2-oxoglutarate dehydrogenase complex catalyzes the overall conversion of 2-oxoglutarate to succinyl-CoA and CO(2). It contains multiple copies of 3 enzymatic components: 2-oxoglutarate dehydrogenase (E1), dihydrolipoamide succinyltransferase (E2) and lipoamide dehydrogenase (E3). [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the predominant transcript, and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.