PCNA (NM_002592) Human Untagged Clone

CAT#: SC118528

PCNA (untagged)-Human proliferating cell nuclear antigen (PCNA), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PCNA (NM_002592) Human Untagged Clone
Symbol PCNA
Synonyms ATLD2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC118528 sequence for NM_002592 edited (data generated by NextGen Sequencing)
ATGTTCGAGGCGCGCCTGGTCCAGGGCTCCATCCTCAAGAAGGTGTTGGAGGCACTCAAG
GACCTCATCAACGAGGCCTGCTGGGATATTAGCTCCAGCGGTGTAAACCTGCAGAGCATG
GACTCGTCCCACGTCTCTTTGGTGCAGCTCACCCTGCGGTCTGAGGGCTTCGACACCTAC
CGCTGCGACCGCAACCTGGCCATGGGCGTGAACCTCACCAGTATGTCCAAAATACTAAAA
TGCGCCGGCAATGAAGATATCATTACACTAAGGGCCGAAGATAACGCGGATACCTTGGCG
CTAGTATTTGAAGCACCAAACCAGGAGAAAGTTTCAGACTATGAAATGAAGTTGATGGAT
TTAGATGTTGAACAACTTGGAATTCCAGAACAGGAGTACAGCTGTGTAGTAAAGATGCCT
TCTGGTGAATTTGCACGTATATGCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATT
TCCTGTGCAAAAGACGGAGTGAAATTTTCTGCAAGTGGAGAACTTGGAAATGGAAACATT
AAATTGTCACAGACAAGTAATGTCGATAAAGAGGAGGAAGCTGTTACCATAGAGATGAAT
GAACCAGTTCAACTAACTTTTGCACTGAGGTACCTGAACTTCTTTACAAAAGCCACTCCA
CTCTCTTCAACGGTGACACTCAGTATGTCTGCAGATGTACCCCTTGTTGTAGAGTATAAA
ATTGCGGATATGGGACACTTAAAATACTACTTGGCTCCCAAGATCGAGGATGAAGAAGGA
TCTTAG

Clone variation with respect to NM_002592.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002592 unedited
NGGGTCAGCATTTGTATACGACTCCTATAGGGCGGCCGCGAATTCGCACGAGGGCGCGCT
TGCGGACGCGGCGGCATTAAACGGTTGCAGGACCAGCAGAGTGGTCGTTGTCTTTCTAGG
TCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGCTCCTGAAGCCGAAACCAG
CTAGACTTTCCTCCTTCCCGCCTGCCTGTAGCGGCGTTGTTGCCACTCCGCCACCATGTT
CGAGGCGCGCCTGGTCCAGGGCTCCATCCTCAAGAAGGTGTTGGAGGCACTCAAGGACCT
CATCAACGAGGCCTGCTGCGATATTAGCTCCAGCGGTGTAAACCTGCAGAGCATGGACTC
GTCCCACGTCTCTTTGGTGCAGCTCACCCTGCGGTCTGAGGGCTTCGACACCTACCGCTG
CGACCGCAACCTGGCCATGGGCGTGAACCTCACCAGTATGTCCAAAATACTAAAATGCGC
CGGCAATGAAGATATCATTACACTAAGGGCCGAAGATAACGCGGATACCTTGGCGCTAGT
ATTTGAAGCACCCAACCAGGAGAAAGTTTCAGACTATGAAATGAAGTTGATGGATTTAGA
TGTTGAACAACTTGGAATTCCAGAACAGGAGTACAGCTGTGTAGTAAAGATGCCTTCTGG
TGAATTTGCACGTATATGCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATTTCCTG
CGCAAAAGACGGAGTGAAATTTTCTGCAAGTGGAGAACTTGGGAATGGAAACATTAAATT
GTCACAGACAAGTAATGTCGATAAAAGANAGGAACCTGTTACCATAGAGATGAATGAACC
AGTNTCACTAACTTTTGCACTGGAGTACCTGAACTTCTTTACAAAGCCACTCCACTCTCT
TCA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002592 unedited
CGCGGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGATGTTTGAAATTCAAGT
AACTTTATTTAAATTCAAAAACAATTCTTAAAACTGCATTTAGAGTCAAGACCCTTTTGT
ATTATAAAAATCACAAGTATTTCTAAGAGACAAAAATACTTCTAGGTTAACTAGACCAGA
TCTGACTTTGGACTTTATTCTTTAAACAAATTGCAGAGAATAGAGAAAAAAATAGGTTAT
TTACAGAAAACAATATCTACATATGTACTTAGAGGTACAAATTTGGTGACAGAAAAGACT
TCAGTATATGCTGGCATCTTAGAAGCAGTTCTCAAAGAGCTTAGTTTTATTTTCTTGAAT
TTTAAGAATGCCTAAGATCCTTCTTCATCCTCGATCTTGGGAGCCAAGTAGTATTTTAAG
TGTCCCATATCCGCAATTTTATACTCTACAACAAGGGGTACATCTGCAGACATACTGAGT
GTCACCGTTGAAGAGAGTGGAGTGGCTTTTGTAAAGAAGTTCAGGTACCTCAGTGCAAAA
GTTAGTTGAACTGGTTCATTCATCTCTATGGTAACAGCTTCCTCCTCTTTATCGACATTA
CTTGTCTGTGACAATTTAATGTTTCCATTTCCAAGNTCTCCACTTGCAGAAATTTCACTC
CGTCTTTTGCACAGGAAATTACCACAGCATCTCCAATATGCCTGAGATCTCGGCATATAC
GTGCAAATTCACCACGAGGCATCTTTACTACACAGCTGTACCTCTGGTCTGAAATTCCAA
GTTGTTAACATCTAAATCCATCCACTTCATTCATAGCCTGAAAACTTCTCTGGTTTGGGG
CCTTAAAAACTACCGCCAAGTATCCCGGTATCTCCGGCCCTTAGGGATGAAACCTCATTG
CCGGCCTTTTAAATTTTGGCTAC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002592
ORF Size 786 bp
Insert Size 1530
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002592.2, NP_002583
RefSeq Size 1355
RefSeq ORF 786
Locus ID 5111
Cytogenetics 20p12.3
Domains PCNA
Protein Families Stem cell - Pluripotency, Druggable Genome
Protein Pathways DNA replication, Base excision repair, Nucleotide excision repair, Mismatch repair, Cell cycle
Gene Summary The protein encoded by this gene is found in the nucleus and is a cofactor of DNA polymerase delta. The encoded protein acts as a homotrimer and helps increase the processivity of leading strand synthesis during DNA replication. In response to DNA damage, this protein is ubiquitinated and is involved in the RAD6-dependent DNA repair pathway. Two transcript variants encoding the same protein have been found for this gene. Pseudogenes of this gene have been described on chromosome 4 and on the X chromosome. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations