RHOB (NM_004040) Human Untagged Clone

CAT#: SC117625

Reviews ()
Write a review

RHOB (untagged)-Human ras homolog gene family, member B (RHOB)



Reconstitution Protocol

USD 429.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RHOB
Synonyms ARH6; ARHB; MST081; MSTP081; RHOH6
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC117625 sequence for NM_004040 edited (data generated by NextGen Sequencing)
ATGGCGGCCATCCGCAAGAAGCTGGTGGTGGTGGGCGACGGCGCGTGTGGCAAGACGTGC
CTGCTGATCGTGTTCAGTAAGGACGAGTTCCCCGAGGTGTACGTGCCCACCGTCTTCGAG
AACTATGTGGCCGACATTGAGGTGGACGGCAAGCAGGTGGAGCTGGCGCTGTGGGACACG
GCGGGCCAGGAGGACTACGACCGCCTGCGGCCGCTCTCCTACCCGGACACCGACGTCATT
CTCATGTGCTTCTCGGTGGACAGCCCGGACTCGCTGGAGAACATCCCCGAGAAGTGGGTC
CCCGAGGTGAAGCACTTCTGTCCCAATGTGCCCATCATCCTGGTGGCCAACAAAAAAGAC
CTGCGCAGCGACGAGCATGTCCGCACAGAGCTGGCCCGCATGAAGCAGGAACCCGTGCGC
ACGGATGACGGCCGCGCCATGGCCGTGCGCATCCAAGCCTACGACTACCTCGAGTGCTCT
GCCAAGACCAAGGAAGGCGTGCGCGAGGTCTTCGAGACGGCCACGCGCGCCGCGCTGCAG
AAGCGCTACGGCTCCCAGAACGGCTGCATCAACTGCTGCAAGGTGCTATGA

Clone variation with respect to NM_004040.2
>OriGene 5' read for NM_004040 unedited
CAAATTTTGTAATACGACTCACTATAGGGCGGCCGCGNAATCGGCACGAGGGCCCCGCTC
ATGGCGGCCATCCGCAAGAAGCTGGTGGTGGTGGGCGACGGCGCGTGTGGCAAGACGTGC
CTGCTGATCGTGTTCAGTAAGGACGAGTTCCCCGAGGTGTACGTGCCCACCGTCTTCGAG
AACTATGTGGCCGACATTGAGGTGGACGGCAAGCAGGTGGAGCTGGCGCTGTGGGACACG
GCGGGCCAGGAGGACTACGACCGCCTGCGGCCGCTCTCCTACCCGGACACCGACGTCATT
CTCATGTGCTTCTCGGTGGACAGCCCGGACTCGCTGGAGAACATCCCCGAGAAGTGGGTC
CCCGAGGTGAAGCACTTCTGTCCCAATGTGCCCATCATCCTGGTGGCCAACAAAAAAGAC
CTGCGCAGCGACGAGCATGTCCGCACAGAGCTGGCCCGCATGAAGCAGGAACCCGTGCGC
ACGGATGACGGCCGCGCCATGGCCGTGCGCATCCAAGCCTACGACTACCTCGAGTGCTCT
GCCAAGACCAAGGAAGGCGTGCGCGAGGTCTTCGAGACGGCCACGCGCGCCGCGCTGCAG
AAGCGCTACGGCTCCCAGAACGGCTGCATCAACTGCTGCAAGGTGCTATGAGGGCCGCGC
CCGTCGCGCCTGCCCCTGCCGGCACGGCTCCCCCTCCTGGACCAGTCCCCCGCGAGCCCG
GAGAAGGGGAGACCCGTGTCCCACAGGACCCCACCGGCCTGCCTGGCATCTGTCTGCTGA
CGCCTCTGGCTTGCGCCAGGACTTGGCGTGGGCACCGGGCGCCCCCATCCCAGTGTCTGT
GTGCGTCCAGCTGTGTTGCACAGGCCTGGGCTCCCACTGAGTGCCAAGGTCCCCTGAGCA
TGCTTTCTGAGAGCCGGCCTCANATGTGTGCTGGTGTCTGTCGACTCCCTCGCCCATTTC
ACCCACCCCGCTCTGTCC
Restriction Sites NotI-NotI     
ACCN NM_004040
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004040.2, NP_004031.1
RefSeq Size 2384 bp
RefSeq ORF 591 bp
Locus ID 388
UniProt ID P62745
Cytogenetics 2p24.1
Domains ras, RAS, RHO, RAB
Protein Families Druggable Genome
Gene Summary Mediates apoptosis in neoplastically transformed cells after DNA damage. Not essential for development but affects cell adhesion and growth factor signaling in transformed cells. Plays a negative role in tumorigenesis as deletion causes tumor formation. Involved in intracellular protein trafficking of a number of proteins. Targets PKN1 to endosomes and is involved in trafficking of the EGF receptor from late endosomes to lysosomes. Also required for stability and nuclear trafficking of AKT1/AKT which promotes endothelial cell survival during vascular development. Serves as a microtubule-dependent signal that is required for the myosin contractile ring formation during cell cycle cytokinesis. Required for genotoxic stress-induced cell death in breast cancer cells.[UniProtKB/Swiss-Prot Function]
Other products for "RHOB"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.