HES1 (NM_005524) Human Untagged Clone

CAT#: SC116707

HES1 (untagged)-Human hairy and enhancer of split 1, (Drosophila) (HES1)

USD 618.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HES1 (NM_005524) Human Untagged Clone
Symbol HES1
Synonyms bHLHb39; HES-1; HHL; HRY
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC116707 sequence for NM_005524 edited (data generated by NextGen Sequencing)
ATGCCAGCTGATATAATGGAGAAAAATTCCTCGTCCCCGGTGGCTGCTACCCCAGCCAGT
GTCAACACGACACCGGATAAACCAAAGACAGCATCTGAGCACAGAAAGTCATCAAAGCCT
ATTATGGAGAAAAGACGAAGAGCAAGAATAAATGAAAGTCTGAGCCAGCTGAAAACACTG
ATTTTGGATGCTCTGAAGAAAGATAGCTCGCGGCATTCCAAGCTGGAGAAGGCGGACATT
CTGGAAATGACAGTGAAGCACCTCCGGAACCTGCAGCGGGCGCAGATGACGGCTGCGCTG
AGCACAGACCCAAGTGTGCTGGGGAAGTACCGAGCCGGCTTCAGCGAGTGCATGAACGAG
GTGACCCGCTTCCTGTCCACGTGCGAGGGCGTTAATACCGAGGTGCGCACTCGGCTGCTC
GGCCACCTGGCCAACTGCATGACCCAGATCAATGCCATGACCTACCCCGGGCAGCCGCAC
CCCGCCTTGCAGGCGCCGCCACCGCCCCCACCGGGACCCGGCGGCCCCCAGCACGCGCCG
TTCGCGCCGCCGCCGCCACTCGTGCCCATCCCCGGGGGCGCGGCGCCCCCTCCCGGCGGC
GCCCCCTGCAAGCTGGGCAGCCAGGCTGGAGAGGCGGCTAAGGTGTTTGGAGGCTTCCAG
GTGGTACCGGCTCCCGATGGCCAGTTTGCTTTCCTCATTCCCAACGGGGCCTTCGCGCAC
AGCGGCCCTGTCATCCCCGTCTACACCAGCAACAGCGGCACCTCCGTGGGCCCCAACGCA
GTGTCACCTTCCAGCGGCCCCTCGCTTACGGCGGACTCCATGTGGAGGCCGTGGCGGAAC
TGA

Clone variation with respect to NM_005524.3
Tag Tag Free
ACCN NM_005524
ORF Size 843 bp
Insert Size 1600
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005524.2, NP_005515
RefSeq Size 1471
Locus ID 3280
Cytogenetics 3q29
Domains HLH, ORANGE
Protein Families Stem cell relevant signaling - DSL/Notch pathway, ES Cell Differentiation/IPS, Adult stem cells, Cancer stem cells, Transcription Factors, Druggable Genome
Protein Pathways Notch signaling pathway, Maturity onset diabetes of the young
Gene Summary This protein belongs to the basic helix-loop-helix family of transcription factors. It is a transcriptional repressor of genes that require a bHLH protein for their transcription. The protein has a particular type of basic domain that contains a helix interrupting protein that binds to the N-box rather than the canonical E-box. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations