DNAJB2 (NM_001039550) Human Untagged Clone

CAT#: SC115897

DNAJB2 (untagged)-Human DnaJ (Hsp40) homolog, subfamily B, member 2 (DNAJB2), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DNAJB2
• Synonyms: CMT2T; DSMA5; HSJ-1; HSJ1; HSPF3
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF within SC115897 sequence for NM_001039550 edited (data generated by NextGen Sequencing)
  ATGGCATCCTACTACGAGATCCTAGACGTGCCGCGAAGTGCGTCCGCTGATGACATCAAG
  AAGGCGTATCGGCGCAAGGCTCTCCAGTGGCACCCAGACAAAAACCCAGATAATAAAGAG
  TTTGCTGAGAAGAAATTTAAGGAGGTGGCCGAGGCATATGAAGTGCTGTCTGACAAGCAC
  AAGCGGGAGATTTACGACCGCTATGGCCGGGAAGGGCTGACAGGGACAGGAACTGGCCCA
  TCTCGGGCAGAAGCTGGCAGTGGTGGGCCTGGCTTCACCTTCACCTTCCGCAGCCCCGAG
  GAGGTCTTCCGGGAATTCTTTGGGAGTGGAGACCCTTTTGCAGAGCTCTTTGATGACCTG
  GGCCCCTTCTCAGAGCTTCAGAACCGGGGTTCCCGACACTCAGGCCCCTTCTTTACCTTC
  TCTTCCTCCTTCCCTGGGCACTCCGATTTCTCCTCCTCATCTTTCTCCTTCAGTCCTGGG
  GCTGGTGCTTTTCGCTCTGTTTCTACATCTACCACCTTTGTCCAAGGACGCCGCATCACC
  ACACGCAGAATCATGGAGAACGGGCAGGAGCGGGTGGAAGTGGAGGAGGATGGGCAGCTG
  AAGTCAGTCACAATCAATGGTGTCCCAGATGACCTGGCACTGGGCTTGGAGCTGAGCCGT
  CGCGAGCAGCAGCCGTCAGTCACTTCCAGGTCTGGGGGCACTCAGGTCCAGCAGACCCCT
  GCCTCATGCCCCTTGGACAGCGACCTCTCTGAGGATGAGGACCTGCAGCTGGCCATGGCC
  TACAGCCTGTCAGAGATGGAGGCAGCTGGGAAGAAACCCGCAGATGTGTTCTGA
  
  Clone variation with respect to NM_001039550.1
  
• Restriction Sites: Please inquire
• ACCN: NM_001039550
• Insert Size: 2000 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: A TrueClone.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001039550.1, NP_001034639.1
• RefSeq Size: 1978 bp
• RefSeq ORF: 834 bp
• Locus ID: 3300
• UniProt ID: P25686
• Cytogenetics: 2q35
• Gene Summary: This gene is almost exclusively expressed in the brain, mainly in the neuronal layers. It encodes a protein that shows sequence similarity to bacterial DnaJ protein and the yeast homologs. In bacteria, this protein is implicated in protein folding and protein complex dissociation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
  Transcript Variant: This variant (1) represents the predominant transcript, and encodes isoform a.