NCX1(SLC8A1) (NM_021097) Human Untagged Clone

CAT#: SC113005

SLC8A1 (untagged)-Human solute carrier family 8 (sodium/calcium exchanger), member 1 (SLC8A1), transcript variant A

USD 1,854.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name NCX1(SLC8A1) (NM_021097) Human Untagged Clone
Symbol SLC8A1
Synonyms NCX1; NCX1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_021097 edited
GAAGAATCCATTCACACTCCCCAAACCAGTAGGTTGTGACAGTTGGAAGTGTCATGTACA
ACATGCGGCGATTAAGTCTTTCACCCACCTTTTCAATGGGATTTCATCTGTTAGTTACTG
TGAGTCTCTTATTTTCCCATGTGGACCATGTAATTGCTGAGACAGAAATGGAAGGAGAAG
GAAATGAAACTGGTGAATGTACTGGATCATATTACTGTAAGAAAGGGGTGATTTTGCCCA
TTTGGGAACCCCAAGACCCTTCTTTTGGGGACAAAATTGCTAGAGCTACTGTGTATTTTG
TGGCCATGGTCTACATGTTTCTTGGAGTCTCTATCATAGCTGATCGGTTCATGTCCTCTA
TAGAAGTCATCACATCTCAAGAAAAAGAAATAACCATAAAGAAACCCAATGGAGAGACCA
CCAAGACAACTGTGAGGATCTGGAATGAAACAGTTTCTAACCTGACCTTGATGGCCCTGG
GATCTTCTGCTCCTGAGATTCTCCTTTCAGTAATTGAAGTGTGTGGCCATAACTTCACTG
CAGGAGACCTCGGTCCTAGCACCATCGTGGGAAGTGCTGCATTCAATATGTTCATCATTA
TTGCACTCTGTGTTTATGTGGTGCCTGACGGAGAGACAAGGAAGATTAAGCATTTGCGTG
TCTTCTTTGTGACAGCAGCCTGGAGCATCTTTGCCTACACCTGGCTTTACATTATTTTGT
CTGTCATATCTCCTGGTGTTGTGGAGGTCTGGGAAGGTTTGCTTACTTTCTTCTTCTTTC
CCATCTGTGTTGTGTTCGCTTGGGTAGCGGATAGGAGACTTCTGTTTTACAAGTATGTCT
ACAAGAGGTATCGAGCTGGCAAGCAGAGGGGGATGATTATTGAACATGAAGGAGACAGGC
CATCTTCTAAGACTGAAATTGAAATGGACGGGAAAGTGGTCAATTCTCATGTTGAAAATT
TCTTAGATGGTGCTCTGGTTCTGGAGGTGGATGAGAGGGACCAAGATGATGAAGAAGCTA
GGCGAGAAATGGCTAGGATTCTGAAGGAACTTAAGCAGAAGCATCCAGATAAAGAAATAG
AGCAATTAATAGAATTAGCTAACTACCAAGTCCTAAGTCAGCAGCAAAAAAGTAGAGCAT
TTTATCGCATTCAAGCTACTCGCCTCATGACTGGAGCTGGCAACATTTTAAAGAGGCATG
CAGCTGACCAAGCAAGGAAGGCTGTCAGCATGCACGAGGTCAACACTGAAGTGACTGAAA
ATGACCCTGTTAGTAAGATCTTCTTTGAACAAGGGACATATCAGTGTCTGGAGAACTGTG
GTACTGTGGCCCTTACCATTATCCGCAGAGGTGGTGATTTGACTAACACTGTGTTTGTTG
ACTTCAGAACAGAGGATGGCACAGCAAATGCTGGGTCTGATTATGAATTTACTGAAGGAA
CTGTGGTGTTTAAGCCTGGTGATACCCAGAAGGAAATCAGAGTGGGTATCATAGATGATG
ATATCTTTGAGGAGGATGAAAATTTCCTTGTGCATCTCAGCAATGTCAAAGTATCTTCTG
AAGCTTCAGAAGATGGCATACTGGAAGCCAATCATGTTTCTACACTTGCTTGCCTCGGAT
CTCCCTCCACTGCCACTGTAACTATTTTTGATGATGACCACGCAGGCATTTTTACTTTTG
AGGAACCTGTGACTCATGTGAGTGAGAGCATTGGCATCATGGAGGTGAAAGTATTGAGAA
CATCTGGAGCTCGAGGAAATGTTATCGTTCCATATAAAACCATCGAAGGGACTGCCAGAG
GTGGAGGGGAGGATTTTGAGGACACTTGTGGAGAGCTCGAATTCCAGAATGATGAAATTG
TCAAAACAATATCAGTCAAGGTAATTGATGATGAGGAGTATGAGAAAAACAAGACCTTCT
TCCTTGAGATTGGAGAGCCCCGCCTGGTGGAGATGAGTGAGAAGAAAGCCCTGTTATTGA
ATGAGCTTGGTGGCTTCACAATAACAGGAAAATACCTGTTTGGCCAACCTGTCTTCAGGA
AGGTTCATGCTAGAGAACATCCGATTCTCTCTACTGTAATCACCATTGCAGACGAATATG
ATGACAAGCAGCCACTGACCAGCAAAGAGGAAGAGGAGAGGCGCATTGCAGAAATGGGGC
GCCCCATCCTGGGAGAGCACACCAAGTTGGAAGTGATCATTGAAGAATCCTATGAATTCA
AGAGTACTGTGGACAAACTCATTAAGAAGACAAACCTGGCCCTTGTGGTTGGGACTAACA
GCTGGAGAGAACAGTTCATTGAAGCTATCACTGTCAGTGCTGGGGAAGATGATGACGACG
ATGAATGTGGGGAAGAGAAGCTGCCCTCCTGTTTCGATTACGTGATGCACTTTCTGACTG
TGTTCTGGAAGGTCCTGTTTGCCTTCGTCCCCCCTACTGAATACTGGAATGGCTGGGCGT
GTTTCATTGTCTCCATCCTCATGATTGGCCTACTGACAGCTTTCATTGGAGACCTGGCTT
CCCACTTTGGCTGCACCATTGGCCTGAAAGATTCTGTGACTGCAGTCGTGTTCGTCGCAC
TTGGAACATCAGTGCCAGACACATTTGCCAGCAAAGTGGCAGCCACCCAGGACCAGTATG
CAGACGCCTCCATAGGTAACGTCACGGGCAGCAACGCGGTGAATGTCTTCCTGGGAATCG
GTGTGGCCTGGTCCATCGCTGCCATCTACCACGCAGCCAATGGGGAACAGTTCAAAGTGT
CCCCTGGCACACTAGCTTTCTCTGTCACTCTCTTCACCATTTTTGCTTTCATCAATGTGG
GGGTGCTGCTGTATCGGCGGAGGCCAGAAATCGGAGGTGAGCTGGGTGGGCCCCGGACTG
CCAAGCTCCTCACATCCTGCCTCTTTGTGCTCCTATGGCTCTTGTACATTTTCTTCTCCT
CCCTGGAGGCCTACTGCCACATAAAAGGCTTCTAAAGGAACTATCAGATATAGTAAATTT
ATATATATACATATATATACATAAAAATTATGTATAATGGACAGAGGAAACTGACATTTG
TCATGTTCACTTACCTGCTGATGGAATCCAGCTTCAAGAGCATACTCTGTACTAGGGCCG
AAGTAAAAAACCATCACCTCCCATTCCCAGGGGCATCATCATGTTCAACAAGGCATGGAG
GCAGGGCCATCTTTGCAGCTCAGTCTAGAAGGGCTGCACTCTCTCCAGGTTGATAAATCC
TTAA
Tag Tag Free
ACCN NM_021097
ORF Size 2922 bp
Insert Size 3200
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_021097.1, NP_066920
RefSeq Size 3250
Locus ID 6546
Cytogenetics 2p22.1
Domains Calx-beta, Na_Ca_Ex
Protein Families Transmembrane
Protein Pathways Calcium signaling pathway, Cardiac muscle contraction, Hypertrophic cardiomyopathy (HCM), Arrhythmogenic right ventricular cardiomyopathy (ARVC), Dilated cardiomyopathy
Gene Summary In cardiac myocytes, Ca(2+) concentrations alternate between high levels during contraction and low levels during relaxation. The increase in Ca(2+) concentration during contraction is primarily due to release of Ca(2+) from intracellular stores. However, some Ca(2+) also enters the cell through the sarcolemma (plasma membrane). During relaxation, Ca(2+) is sequestered within the intracellular stores. To prevent overloading of intracellular stores, the Ca(2+) that entered across the sarcolemma must be extruded from the cell. The Na(+)-Ca(2+) exchanger is the primary mechanism by which the Ca(2+) is extruded from the cell during relaxation. In the heart, the exchanger may play a key role in digitalis action. The exchanger is the dominant mechanism in returning the cardiac myocyte to its resting state following excitation.[supplied by OMIM, Apr 2004].
Transcript Variant: This variant (A) represents the longest transcript and encodes the longest isoform (A), also known as NaCa1 or NCX1.1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.