PPP3CB (NM_021132) Human Untagged Clone

CAT#: SC112977

PPP3CB (untagged)-Human protein phosphatase 3, catalytic subunit, beta isozyme (PPP3CB), transcript variant 2

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PPP3CB (NM_021132) Human Untagged Clone
Symbol PPP3CB
Synonyms CALNA2; CALNB; CNA2; PP2Bbeta
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_021132, the custom clone sequence may differ by one or more nucleotides


ATGGCCGCCCCGGAGCCGGCCCGGGCTGCACCGCCCCCACCCCCGCCCCCGCCGCCCCCTCCCGGGGCTG
ACCGCGTCGTCAAAGCTGTCCCTTTCCCCCCAACACATCGCTTGACATCTGAAGAAGTATTTGATTTGGA
TGGGATACCCAGGGTTGATGTTCTGAAGAACCACTTGGTGAAAGAAGGTCGAGTAGATGAAGAAATTGCG
CTTAGAATTATCAATGAGGGTGCTGCCATCCTTCGGAGAGAGAAAACCATGATAGAAGTAGAAGCTCCAA
TCACAGTGTGTGGTGACATCCATGGCCAATTTTTTGATCTGATGAAACTTTTTGAAGTAGGAGGATCACC
TGCTAATACACGATACCTTTTTCTTGGCGATTATGTGGACAGAGGTTATTTTAGTATAGAGTGTGTCTTA
TATTTATGGGTTCTGAAGATTCTATACCCAAGCACATTATTTCTTCTGAGAGGCAACCATGAATGCAGAC
ACCTTACTGAATATTTTACCTTTAAGCAGGAATGTAAAATTAAGTATTCGGAAAGAGTCTATGAAGCTTG
TATGGAAGCTTTTGATAGTTTGCCTCTTGCTGCACTTTTAAACCAACAGTTTCTTTGTGTTCATGGTGGA
CTTTCACCAGAAATACACACACTGGATGATATTAGGAGATTAGATAGATTCAAAGAGCCACCTGCATTTG
GACCAATGTGTGACTTGTTATGGTCCGATCCTTCTGAAGATTTTGGAAATGAAAAATCACAGGAACATTT
TAGTCACAATACAGTTCGAGGATGTTCTTATTTTTATAACTATCCAGCAGTGTGTGAATTTTTGCAAAAC
AATAATTTGTTATCGATTATTAGAGCTCATGAAGCTCAAGATGCAGGCTATAGAATGTACAGAAAAAGTC
AAACTACAGGGTTCCCTTCATTAATAACAATTTTTTCGGCACCTAATTACTTAGATGTCTACAATAATAA
AGCTGCTGTATTAAAGTATGAAAATAATGTGATGAATATTCGACAGTTTAACTGTTCTCCACATCCTTAC
TGGTTGCCTAATTTTATGGATGTCTTCACGTGGTCTTTACCGTTTGTTGGAGAAAAAGTGACAGAAATGT
TGGTAAATGTTCTGAGTATTTGCTCTGATGATGAACTAATGACTGAAGGTGAAGACCAGTTTGATGGTTC
AGCTGCAGCCCGGAAAGAAATCATAAGAAACAAAATTCGAGCAATTGGCAAGATGGCAAGAGTCTTCTCT
GTTCTCAGGGAGGAGAGTGAAAGTGTGCTGACACTCAAGGGCCTGACTCCCACAGGGATGTTGCCTAGTG
GAGTGTTAGCTGGAGGACGGCAGACCCTGCAAAGTGCCACAGTTGAGGCTATTGAGGCTGAAAAAGCAAT
ACGAGGATTCTCTCCACCACATAGAATCTGCAGTTTTGAAGAGGCAAAGGGTTTGGATAGGATCAATGAG
AGAATGCCACCTCGGAAAGATGCTGTACAGCAAGATGGTTTCAATTCTCTGAACACCGCACATGCCACTG
AGAACCACGGGACGGGCAACCATACTGCCCAGTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_021132 unedited
NGGGGTCGAATATTTGTATACGACTCACTATAGGGCGGCCGCGNAATTCGCACGAGAAGC
CGAGCCCCGGGCCCAGCATGGCCGCCCCGGAGCCGGCCCGGGCTGCACCGCCCCCACCCC
CGCCCCCGCCGCCCCCTCCCGGGGCTGACCGCGTCGTCAAAGCTGTCCCTTTCCCCCCAA
CACATCGCTTGACATCTGAAGAAGTATTTGATTTGGATGGGATACCCAGGGTTGATGTTC
TGAAGAACCACTTGGTGAAAGAAGGTCGAGTAGATGAAGAAATTGCGCTTAGAATTATCA
ATGAGGGTGCTGCCATCCTTCGGAGAGAGAAAACTATGATAGAAGTAGAAGCTCCAATCA
CAGTGTGTGGTGACATCCATGGCCAATTTTTTGATCTGATGAAACTTTTTGAAGTAGGAG
GATCACCTGCTAATACACGATACCTTTTTCTTGGCGATTATGTGGACAGAGGTTATTTTA
GTATAGAGTGTGTCTTATATTTATGGGTTCTGAAGATTCTATACCCAAGCACATTATTTC
TTCTGAGAGGCAACCATGAATGCAGACACCTTACTGAATATTTTACCTTTAAGCAGGAAT
GTAAAATTAAGTATTCGGAAAGAGTCTATGAAGCTTGTATGGAAGCTTTTGATAGTTTGC
CTCTTGCTGCACTNTTAAACCAACAGTTTCTTTGTGTTCATGGTGGACTCTCACCAGAAA
TACACACACTGGATGATATTAGGAGATTAGATAGATTCAAAGAGCCACCTGCATTTGGAC
CAATGTGTGACTTGTTATGGTCCGATCCTTTCTGAGATTTGGAAATGAANAATCACAGGA
CATTTTAGTCCAATACAGTTCGAGGAGTTCCTATTTTTATACTATCCAGCAGGGTGTGAA
TT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_021132 unedited
CGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGGGAGCAGCGGCCCATGCA
TGGAATTTATTGTGTGCTACTGTTTATAAAATACTCGAATAGTCCTGCACATGCATAATA
TTTCCAACTTAGACAGGAGACCATACAGGGTGCACTTTCTGGCAAACAAAACAATAGATG
GTTCCGCTGCCTGGAGCTCTGAGTTGTATTCCAGGGCATGAGGGAAGCAGGCCACCAAAG
TAAAGGGAAATACCAAACTACAGTGGCAATCAATACAGGTCAATAATTGTGAAAAATTAG
CACATGGTTCCATTTAGTTTAACCAAGCAGTTCAGTAACTATCAAAAGAAAGGTTTCAAC
ATGCAGTCTTGACTTTTATGCTTCCACTAACATCTGAATGATTGAACAGAACCATTGCTT
CTAGGCTGCATTGCTTAATCAAAAACACTTCCAGAACATTTTAAAATTTCCTTTGCATTA
AAACATAAAAATGATAGAAAGCCAGCAGCAAATCACCCTGGTGGCTCTCTAAGCAACTTG
AGTACTCACAATAAACTAAAATTTCTCATAACATCTAGGTAACCTATACATGTCGTACCT
GTACATCATAGGTCTATATATTAAATATTTGCAAAATGAAAACATGCATACACAAAATAC
GTCAAGTTTACAGACATGACTTGAATTAAAATTTACTTTGACAATGTACAAACTTCTTTT
AAAGTACCTTAAATGAGCAAATTCTGTAATTCTTCATTAATTTGAAAATTTAGAGGTTTT
CTTTTTTAAATCTCTTGGGTGTAAGGCCTTAAAGAAATGGGCCCAAAAAAACTCTAATTA
ACTTTTGGGCTTGCGTTCAAGTAAGAAAACCTGCCTGAAAATAGGATTCCTTTCTTATTA
AAAAATCCCCACTTTGTCCCAAATACCCCCTTTAG
Restriction Sites ECoRI-NOT     
Tag Tag Free
ACCN NM_021132
ORF Size 1575 bp
Insert Size 3000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_021132.1, NP_066955
RefSeq Size 3079
RefSeq ORF 1575
Locus ID 5532
Cytogenetics 10q22.2
Domains Metallophos, PP2Ac
Protein Families Phosphatase, Transcription Factors, Druggable Genome
Protein Pathways MAPK signaling pathway, Calcium signaling pathway, Oocyte meiosis, Apoptosis, Wnt signaling pathway, Axon guidance, VEGF signaling pathway, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway, B cell receptor signaling pathway, Long-term potentiation, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS)
Gene Summary Calcium-dependent, calmodulin-stimulated protein phosphatase. This subunit may have a role in the calmodulin activation of calcineurin. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1. It encodes isoform b which is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.