PSME1 (NM_006263) Human Untagged Clone

CAT#: SC111680

PSME1 (untagged)-Human proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) (PSME1), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PSME1 (NM_006263) Human Untagged Clone
Symbol PSME1
Synonyms IFI5111; PA28A; PA28alpha; REGalpha
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC111680 sequence for NM_006263 edited (data generated by NextGen Sequencing)
ATGGCCATGCTCAGGGTCCAGCCCGAGGCCCAAGCCAAGGTGGATGTGTTTCGTGAAGAC
CTCTGTACCAAGACAGAGAACCTGCTCGGGAGCTATTTCCCCAAGAAGATTTCTGAGCTG
GATGCATTTTTAAAGGAGCCAGCTCTCAATGAAGCCAACTTGAGCAATCTGAAGGCCCCA
TTGGACATCCCAGTGCCTGATCCAGTCAAGGAGAAAGAGAAAGAGGAGCGGAAGAAACAG
CAGGAGAAGGAAGACAAGGATGAAAAGAAGAAGGGGGAGGATGAAGACAAAGGTCCTCCC
TGTGGCCCAGTGAACTGCAATGAAAAGATCGTGGTCCTTCTGCAGCGCTTGAAGCCTGAG
ATCAAGGATGTCATTGAGCAGCTCAACCTGGTCACCACCTGGTTGCAGCTGCAGATACCT
CGGATTGAGGATGGTAACAATTTTGGAGTGGCTGTCCAGGAGAAGGTGTTTGAGCTGATG
ACCAGCCTCCACACCAAGCTAGAAGGCTTCCACACTCAAATCTCTAAGTATTTCTCTGAG
CGTGGTGATGCAGTGACTAAAGCAGCCAAGCAGCCCCATGTGGGTGATTATCGGCAGCTG
GTGCACGAGCTGGATGAGGCAGAGTACCGGGACATCCGGCTGATGGTCATGGAGATCCGC
AATGCTTATGCTGTGTTATATGACATCATCCTGAAGAACTTCGAGAAGCTCAAGAAGCCC
AGGGGAGAAACAAAGGGAATGATCTATTGA

Clone variation with respect to NM_006263.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_006263 unedited
ACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGAGCTGGGTGCGAGCGCCCTACC
GCTTTCGCTTTCCCTTCGCGGTGCCCACTCCACTCCTTGTGCGGCGCTAGGCCCCCCGTC
CCGGTCATGGCCATGCTCAGGGTCCAGCCCGAGGCCCAAGCCAAGGTGGATGTGTTTCGT
GAAGACCTCTGTACCAAGACAGAGAACCTGCTCGGGAGCTATTTCCCCAAGAAGATTTCT
GAGCTGGATGCATTTTTAAAGGAGCCAGCTCTCAATGAAGCCAACTTGAGCAATCTGAAG
GCCCCATTGGACATCCCAGTGCCTGATCCAGTCAAGGAGAAAGAGAAAGAGGAGCGGAAG
AAACAGCAGGAGAAGGAAGACAAGGATGAAAAGAAGAAGGGGGAGGATGAAGACAAAGGT
CCTCCCTGTGGCCCAGTGAACTGCAATGAAAAGATCGTGGTCCTTCTGCAGCGCTTGAAG
CCTGAGATCAAGGATGTCATTGAGCAGCTCAACCTGGTCACCACCTGGTTGCAGCTGCAG
ATACCTCGGATTGAGGATGGTAACAATTTTGGAGTGGCTGTCCAGGAGAAGGTGTTTGAG
CTGATGACCAGCCTCCACACCAAGCTAGAAGGCTTCCACACTCAAATCTCTAAGTATTTC
TCTGAGCGTGGTGATGCAGTGACTAAAGCAGCCAAGCAGCCCCATGTGGGTGATTATCGG
CAGCTGGTGCACGAGCTGGATGAGGCANAGTACCGGGACATCCGGCTGATGGTATGGNAG
ATCCGCAATGCTTNATGCTGTNGTATATGACATCATNCTGAAAGACTTCGAGAGCTCAAG
AAGCCAGGGGAGAACAAGGGGATGATTATTNGAGACCCTCTCTCCCANCTGTGATGAGTC
ANCANAGACTTNCTGCNTTTACATGGGACTNCAGATTTNCCNNAACTGCTCTGTTGAGAA
TTTNCCTNACCTTGCCCTTAG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_006263 unedited
GCCGCGCCCCCGGCCCNCCNNNCCCCCCCCCCCNCCCCCCCCCCTTTTTCCCCCTCTATT
CTTATGTGTCCTGTANGAGCAGGTTGAGGGCAAAAACTCACAGAGCAGTTTGGGGAAAAC
TGGAGTCCCCAGTAAAAACCACGCAAGTCTCTGCTGTACTCATCACAGAATGGGAGAGAG
GGCTCTCAATAGATCATTCCCTCTGTTTCTCCCCTGGGCTTCTTGAGCTTCTCGAAGTTC
TTCACGATGATGTCATATAACACAGCATAAGCATTGCGGATCTCCATGACCATTATCCGG
ATGTCCCGGTACTCTGCCTCATCCACCTCGTGCACCATCTGCCGATAATCACCCACATGG
GGCTGCTTGGCTGCTTTACCCACTGCATCACCACGCTCACAGAAATACTTATAGATTTGA
GTGCGGAAGCCTTCTACCTCGGTGTGGAGGCTGGCCATTAGTTTAAACACCTCCTCCTGC
ACAGTCACTCCAAAATTGTTACCATCTCTCAATCCCAGGTATCTGCATCTGCAACCAGTT
GGTGACCAGGTTGACCCGTTCAATGACATCCCAGATCTCAAGTTTCAAGCTCTGACGAAC
GACCACCATCCTTTTATTGTTCCTCACCTGTGCCACATGGAGGACCTTAGCCTTCATCCC
TCCCCTTCTTCTTTCTAACCCCGCCTTCCTTCTCCTGCAGTCCCTTCCGCTCCTCCTCCT
CTTTCCCCTTGACTGGATCAGGCACTGGGATTTCCAATGGGGCCCTTCCATTGCTAATAT
CGCTCCATGCACACCCTCCTCCCTCACAAAGCTTCCACCCCACAAATTCTCTTGGCGACA
CACCTCCCTCACCAGTTCTTCTTCCTCGAAACATAGCTATCCCCACCCACATCACATCCC
ATCGGTACTCGTGCTGGATCCTTTATC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006263
ORF Size 750 bp
Insert Size 1190
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006263.2, NP_006254
RefSeq Size 1012
RefSeq ORF 750
Locus ID 5720
Cytogenetics 14q12
Domains PA28_alpha, PA28_beta
Protein Pathways Proteasome, Antigen processing and presentation
Gene Summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the alpha subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three alpha and three beta subunits combine to form a heterohexameric ring. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013].
Transcript Variant: This variant (1) encodes isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.