Cannabinoid Receptor I(CNR1) (NM_016083) Human Untagged Clone

CAT#: SC111611

CNR1 (untagged)-Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 1

USD 505.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cannabinoid Receptor I(CNR1) (NM_016083) Human Untagged Clone
Symbol CNR1
Synonyms CANN6; CB-R; CB1; CB1A; CB1K5; CB1R; CNR
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC111611 sequence for NM_016083 edited (data generated by NextGen Sequencing)
ATGAAGTCGATCCTAGATGGCCTTGCAGATACCACCTTCCGCACCATCACCACTGACCTC
CTGTACGTGGGCTCAAATGACATTCAGTACGAAGACATCAAAGGTGACATGGCATCCAAA
TTAGGGTACTTCCCACAGAAATTCCCTTTAACTTCCTTTAGGGGAAGTCCCTTCCAAGAG
AAGATGACTGCGGGAGACAACCCCCAGCTAGTCCCAGCAGACCAGGTGAACATTACAGAA
TTTTACAACAAGTCTCTCTCGTCCTTCAAGGAGAATGAGGAGAACATCCAGTGTGGGGAG
AACTTCATGGACATAGAGTGTTTCATGGTCCTGAACCCCAGCCAGCAGCTGGCCATTGCA
GTCCTGTCCCTCACGCTGGGCACCTTCACGGTCCTGGAGAACCTCCTGGTGCTGTGCGTC
ATCCTCCACTCCCGCAGCCTCCGCTGCAGGCCTTCCTACCACTTCATCGGCAGCCTGGCG
GTGGCAGACCTCCTGGGGAGTGTCATTTTTGTCTACAGCTTCATTGACTTCCACGTGTTC
CACCGCAAAGATAGCCGCAACGTGTTTCTGTTCAAACTGGGTGGGGTCACGGCCTCCTTC
ACTGCCTCCGTGGGCAGCCTGTTCCTCACAGCCATCGACAGGTACATATCCATTCACAGG
CCCCTGGCCTATAAGAGGATTGTCACCAGGCCCAAGGCCGTGGTGGCGTTTTGCCTGATG
TGGACCATAGCCATTGTGATCGCCGTGCTGCCTCTCCTGGGCTGGAACTGCGAGAAACTG
CAATCTGTTTGCTCAGACATTTTCCCACACATTGATGAAACCTACCTGATGTTCTGGATC
GGGGTCACCAGCGTACTGCTTCTGTTCATCGTGTATGCGTACATGTATATTCTCTGGAAG
GCTCACAGCCACGCCGTCCGCATGATTCAGCGTGGCACCCAGAAGAGCATCATCATCCAC
ACGTCTGAGGATGGGAAGGTACAGGTGACCCGGCCAGACCAAGCCCGCATGGACATTAGG
TTAGCCAAGACCCTGGTCCTGATCCTGGTGGTGTTGATCATCTGCTGGGGCCCTCTGCTT
GCAATCATGGTGTATGATGTCTTTGGGAAGATGAACAAGCTCATTAAGACGGTGTTTGCA
TTCTGCAGTATGCTCTGCCTGCTGAACTCCACCGTGAACCCCATCATCTATGCTCTGAGG
AGTAAGGACCTGCGACACGCTTTCCGGAGCATGTTTCCCTCTTGTGAAGGCACTGCGCAG
CCTCTGGATAACAGCATGGGGGACTCGGACTGCCTGCACAAACACGCAAACAATGCAGCC
AGTGTTCACAGGGCCGCAGAAAGCTGCATCAAGAGCACGGTCAAGATTGCCAAGGTAACC
ATGTCTGTGTCCACAGACACGTCTGCCGAGGCTCTGTGA

Clone variation with respect to NM_016083.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_016083 unedited
ACTCACTATAGGGCGGCCCGCGATTCGGCACGAGGGCCTAATCAAAGACTGAGGTTATGA
AGTCGATCCTAGATGGCCTTGCAGATACCACCTTCCGCACCATCACCACTGACCTCCTGT
ACGTGGGCTCAAATGACATTCAGTACGAAGACATCAAAGGTGACATGGCATCCAAATTAG
GGTACTTCCCACAGAAATTCCCTTTAACTTCCTTTAGGGGAAGTCCCTTCCAAGAGAAGA
TGACTGCGGGAGACAACCCCCAGCTAGTCCCAGCAGACCAGGTGAACATTACAGAATTTT
ACAACAAGTCTCTCTCGTCCTTCAAGGAGAATGAGGAGAACATCCAGTGTGGGGAGAACT
TCATGGACATAGAGTGTTTCATGGTCCTGAACCCCAGCCAGCAGCTGGCCATTGCAGTCC
TGTCCCTCACGCTGGGCACCTTCACGGTCCTGGAGAACCTCCTGGAGCTGTGCGTCATCC
TCCACTCCCGCAGCCTCCGCTGCAGGCCTTCCTACCACTTCATCGGCAGCCTGGCGGTGG
CAGACCTCCTGGGGAGTGTCATTTTTGTCTACAGCTTCATTGACTTCCACGTGTTCCACC
GCATAGATAGCCGCAACGTGTTTCTGTTCAAACTGGGTGGGGTCACGGNCTCCTTCACTG
CCTACGTGGGCAGCCTGTTCCTCACAGCCATCGACAGGTACATATCCATTCACAGGCCCC
TGGCCTATAAGAGGATTGTCACCAGGCCCAAGGCCGCTGGTGGCGTTTTGCCTGATGTGC
ACCATAGCCATTGTGATCGCCGTGCTGCCTCTTCTGGGCTGGGACTGCNAGAACTGCAAT
CTGGTTGCTCAGACATTTCCCACAC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_016083 unedited
NNNGGGTATACTATGNNACCGCGGCCGCATNCTAGNGATCGATTTTTTTTTTTTTTTTTT
TTGTTCTTCATGGTAATCTAGAATTTTTATTTGATTCCAGGTAACTTTGGACAATAGACA
TGATGAGATGTTTTCTCTTTGAATAAGTTAACAGTTTAATTACATTGAAATAAAATATAC
TGTGGGCTTAATACATTGTAAATATTACAGAAGAAGTACTACTTTGCTATAGTAATTTAA
TGACTGAAGCTACATTTAATAACAATCTTACCAGTACTTGTATACAAAGTATTATACAGA
TTACTAACGAAGATATTGCAGTGGTTGCAACGATGTTACCAGCTCAACAAACATCTAACA
ATACAATATTCTTCTAAGAGGAAAAGTAATAATGTTAGATTTACAGACAATAAAGAGTCA
TGTTTCCCGCTTGAAACATTGGAAATAAATTTGAATCCAGATACAAGAAAAGGTTTCCTT
TCTTGGGAACTCTGATCCCCAGTAGGCCTAGTACAGTCAATTTACATGAAGATAGCTTTT
AAGATGCCACGGCAATGTAAAGAAACTCTCCCATCCGAAAATTACTGATTTGTAGGCCAC
CTGCTCAAACATCTGACTTTTTAGAAACCTATTTACATACATTCAGCCCAAATCAATAGA
AAGAATGTTTTTTTCTATATTACCATAGGCACTTGTAACCTTTCCACCAAAGGGCCGTGC
GAGACAATCAATGTTAAAAGCCTTGGCCCCCCTTTAGGAAAATTTAAAGCCCCACCAATT
TTCACCTCGAGTGCGGCAATCCCACTTTTGGCTGATTCGGCGGGACCCTTAGACAGCCGC
GCACGGCCACCCATTAACCACCGGACCGCATCACATCGCTCAN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_016083
ORF Size 1419 bp
Insert Size 5700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_016083.3, NP_057167
RefSeq Size 5486
Locus ID 1268
Cytogenetics 6q15
Domains 7tm_1
Protein Families GPCR, Transmembrane, Druggable Genome
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary This gene encodes one of two cannabinoid receptors. The cannabinoids, principally delta-9-tetrahydrocannabinol and synthetic analogs, are psychoactive ingredients of marijuana. The cannabinoid receptors are members of the guanine-nucleotide-binding protein (G-protein) coupled receptor family, which inhibit adenylate cyclase activity in a dose-dependent, stereoselective and pertussis toxin-sensitive manner. The two receptors have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. Multiple transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, May 2009]
Transcript Variant: This variant (1) encodes the longer isoform (a). Variant 1 has also been called CB1A by PubMed ID: 15289816. Variants 1, 3, 4 and 5 all encode isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations